Transcript asmbl_51641

Sequence
Transcript Sequence for observation asmbl_51641 of TGE0056240:
GGAATTACGAAATGGAGAAGGGGGAGAAGTGAGCTAGTGGCAGCATAAAAAGACCAGCAGATGCCCCACAGCACTGCTCTTCCAGAGGCAAGACCAACCAAGATGAGTGCCCTGGGAGCTGTCATTGCCCTCCTGCTCTGGGGACAGCTTTTTGCAGTGGACTCAGGCAATGATGTCACGGATATCGCAGATGACGGCTGCCCGAAGCCCCCCGAGATTGCACATGGCTATGTGGAGCACTCGGTTCGCTACCAGTGTAAGAACTACTACAAACTGCGCACAGAAGGAGATGGAGTGTACACCTTAAACAATGAGAAGCAGTGGATAAATAAGGCTGTTGGAGATAAACTTCCTGAATGTGAAGCAGTATGTGGGAAGCCCAAGAATCCGGCAAACCCAGTGCAGCGGATCCTGGGTGGACACCTGGATGCCAAAGGCAGCTTTCCCTGGCAGGCTAAGATGGTTTCCCACCATAATCTCACCACAGGTGCCACGCTGATCAATGAACAATGGCTGCTGACCACGGCTAAAAATCTCTTCCTGAACCATTCAGAAAATGCAACAGCGAAAGACATTGCCCCTACTTTAACACTCTATGTGGGGAAAAAGCAGCTTGTAGAGATTGAGAAGGTTGTTCTACACCCTAACTACTCCCAGGTAGATATTGGGCTCATCAAACTCAAACAGAAGGTGTCTGTTAATGAGAGAGTGATGCCCATCTGCCTACCTTCAAAGGATTATGCAGAAGTAGGGCGTGTGGGTTATGTTTCTGGCTGGGGGCGAAATGCCAATTTTAAATTTACTGACCATCTGAAGTATGTCATGCTGCCTGTGGCTGACCAAGACCAATGCATAAGGCATTATGAAGGCAGCACAGTCCCCGAAAAGAAGACACCGAAGAGCCCTGTAGGGGTGCAGCCCATACTGAATGAACACACCTTCTGTGCTGGCATGTCTAAGTACCAAGAAGACACCTGCTATGGCGATGCGGGCAGTGCCTTTGCCGTTCACGACCTGGAGGAGGACACCTGGTATGCGACTGGGATCTTAAGCTTTGATAAGAGCTGTGCTGTGGCTGAGTATGGTGTGTATGTGAAGGTGACTTCCATCCAGGACTGGGTTCAGAAGACCATAGCTGAGAACTAATGCAAGGCTGGCCGGAAGCCCTTGCCTGAAAGCAAGATTTCAGCCTGGAAGAGGGCAAAGTGGACGGGAGTGGACAGGAGTGGATGCGATAAGATGTGGTTTGAAGCTGATGGGTGCCAGCCCTGCATTGCTGAGTCAATCAATAAAGAGCTTTCTTTTGACCCA