Transcript asmbl_51221

Sequence
Transcript Sequence for observation asmbl_51221 of TGE0059636:
TGGGGACCCAGGGGCTGGGAGAGGGGCTCTAGGATGGGATCTGACATTTGGAGTCCTGAAGACTCACTGGCCCCTCCTCTGCAGGTGTGGGAGATCCCAGATGGGGGCCTGATGCTGCCCCTGCGGGAGCCCGTCGTCACCCTGGAGGGCCACACCAAGCGTGTGGGCATTGTGGCCTGGCACACCACAGCCCAGAACGTGCTGCTCAGTGCAGGTGCTGCGGGAGGAGGGGCTTGGGGGTGGCTCGTGGCCTGCAGTGGATGAGGGCAGGAGGCTCATGGCTTCTGACACTGTGGGGAACGTGCAGGTTGTGACAACGTGATCATGGTGTGGGACGTGGGCACTGGGGCGGCCATGCTGACACTGGGCCCAGAGGTGCACCCAGACACGATCTACAGTGTGGACTGGAGCCGAGATGGAGGCCTCATTTGTACCTCCTGCCGTGACAAGCGCGTGCGCATCATCGAGCCCCGCAAAGGCACTGTCGTAGCTGAGAAGGACCGTCCCCACGAGGGGACCCGGCCCGTGCGTGCAGTGTTCGTGTCGGAGGGGAAGATCCTGACCACGGGCTTCAGCCGCATGAGTGAGCGGCAGGTGGCGCTGTGGGACACAAAGCACCTGGAGGAGCCGCTGTCCCTGCAGGAGCTGGACACCAGCAGCGGTGTCCTGCTGCCCTTCTTTGACCCTGACACCAACATCGTCTACCTCTGTGGCAAGGGTGACAGCTCAATCCGGTACTTTGAGATCACTTCCGAGGCCCCTTTCCTGCACTATCTCTCCATGTTCAGTTCCAAGGAGTCCCAGCGGGGCATGGGCTACATGCCCAAACGTGGCCTGGAGGTGAACAAGTGTGAGATCGCCAGGTTCTACAAGCTGCACGAGCGGAGGTGTGAGCCCATTGCCATGACAGTGCCTCGAAAGTCGGACCTGTTCCAGGAGGACCTGTACCCACCCACCGCAGGGCCCGACCCTGCCCTCACGGCTGAGGAGTGGCTGGGGGGTCGGGATGCTGGGCCCCTCCTCATCTCCCTCAAGGATGGCTACGTACCCCCAAAGAGCCGGGAGCTGAGGGTCAACCGGGGCCTGGACACCGGGCGCAGGAGGGCAGCACCAGAGGCCAGTGGCACTCCCAGCTCGGATGCCGTGTCTCGGCTGGAGGAGGAGATGCGGAAGCTCCAGGCCACGGTGCAGGAGCTCCAGAAGCGCTTGGACAGGCTGGAGGAGACAGTCCAGGCCAAGTAGAGCCCCGCAGGGCCTCCAGCAGGGTCAGCCATTCACACCCATCCACTCACCTCCCATTCCCAGCCACATGGCAGAGAAAAAAATCATAATAAAATGGCTTTATTTTCTGGTA