Transcript asmbl_51220

Sequence
Transcript Sequence for observation asmbl_51220 of TGE0059638:
TTCCTCCTCTTCCTCCTCCTCCTCCACCTCCGGCTTTTGGGGGATCACTGTCCTCTCTCGGCAGCAGAATGAGCCGGCAGGTGGTCCGCTCCAGCAAGTTCCGCCACGTGTTTGGACAGCCGGCCAAGGCCGACCAGTGCTATGAAGATGTGCGCGTCTCACAGACCACCTGGGACAGTGGCTTCTGTGCTGTCAACCCTAAGTTTGTGGCCCTGATCTGTGAGGCCAGCGGGGGAGGGGCCTTCCTGGTGCTGCCCCTGGGCAAGGTGAGCCCCTGGGGCCCTGGGGGGAGCAGCTCCTCCACCGGACCCATGGCTCTGTGCAGGTCCTGATTAGGTGACGGTCACCAGGCCTTCCAGGGCCTGTGTTGCCATCTGGAAAACTGAGCTGGGCCCCATGAGCCTTACACTTCCTCCAGCTCCTCTGTGCTGTGGCTGTGTGGAAACTGACGCTCAGAAGGAGCCAACACAAGATGGGTCACACCAGTGACCAGGACTACAGACAGTCCTGCAGACCCATGATCAGCCCTCCTGAGCCTCAGCCTGGGGCTTTCTCCCCATGGAAACACAGAGGGGGTTGGGATGGGGTCTGGGGGCCCTGGCAGCGTTCTCAGGGTTGGGAGGGACTCTGGCTCTGGGCCTGTCTGAGGACCTAGCAACTCTGTCCCCCAGCTCGCAGGCAGGGATGATGCAAGAGGTGCTCTCCCCCACCCGCAGCCCTGCCCTCCCCTGGAGCCTGCTGCCCCCTCCGCTGGCTGGCTGCTGCCCCGCACCCCCAGCACACTCCTGTGCTCTTTGGGGGGTAAGACAGGAAGGGGAGATGGGCCCCAAGTTGTTACCTTAAAAGGGCTGATGGAAGCAAAGAGAAGAGGAAGTGGTTGTCGGGGTGAGAGCTGGGCCCGCGCCCCACATGGCTGTCACACAGGAAGCCCTGCTGAAGCAGCTGTCCCCGGAAGAAGCCATTTCCAAACCTCTGCTCCTGCCTGGGGCCAGTTGGGACAGGCTCCCTGGCCCCTCTCCTTTTGGGAGGACCCACCCCTGCAGCCCCACCACTCACACTCGCTCTCTGGGGAGCTGCCTCCACCCCCCCAGCCCCCATACACCTGTCCTGGCTCCAGGGCCAGTTGTGCCCATGGAAGCCTCACTCGGGGAAGCTGGGGTGGGGGTGCCAACCCTAAGGGCAGAGACAGACTGAGACAGAGACCGGCGGGAACTCTGCCAGGGTCTTGCACGGCCCCCAACCTCTGCCATGCGTGGCCAGCCCTCCTGGGGTTTGCCCAGGCCATTTTGGGACTGGAACAAGAGAAGAACAACCCGCCCCCGTCCCCACCCCAGGCCCTGGTCCAGCTCCCAGGGACACCACAGCTTTCCTCTCTGGGCCTCTCTGAAGGAGGTGTGGGGAGGTTGGATTGGGTTTGGGAGGCAAAAGCACCTCCAAGGCCCTGCTGTGCCTTTAGACTGGACGTGTGGACAAGAATGCGCCCACGGTCTGTGGCCACACAGCCCCTGTGCTAGACATCGCCTGGTGCCCGCACAATGACAACGTCATTGCCAGTGGCTCCGAGGACTGCACAGTCATGGTGTGGGAGATCCCAGATGGGGGCCTGATGCTGCCCCTGCGGGAGCCCGTCGTCACCCTGGAGGGCCACACCAAGCGTGTGGGCATTGTGGCCTGGCACACCACAGCCCAGAACGTGCTGCTCAGTGCAGGTTGTGACAACGTGATCATGGTGTGGGACGTGGGCACTGGGGCGGCCATGCTGACACTGGGCCCAGAGGTGCACCCAGACACGATCTACAGTGTGGACTGGAGCCGAGATGGAGGCCTCATTTGTACCTCCTGCCGTGACAAGCGCGTGCGCATCATCGAGCCCCGCAAAGGCACTGTCGTAGCTGAGAAGGACCGTCCCCACGAGGGGACCCGGCCCGTGCGTGCAGTGTTCGTGTCGGAGGGGAAGATCCTGACCACGGGCTTCAGCCGCATGAGTGAGCGGCAGGTGGCGCTGTGGGACACAAAGCACCTGGAGGAGCCGCTGTCCCTGCAGGAGCTGGACACCAGCAGCGGTGTCCTGCTGCCCTTCTTTGACCCTGACACCAACATCGTCTACCTCTGTGGCAAGGGTGACAGCTCAATCCGGTACTTTGAGATCACTTCCGAGGCCCCTTTCCTGCACTATCTCTCCATGTTCAGTTCCAAGGAGTCCCAGCGGGGCATGGGCTACATGCCCAAACGTGGCCTGGAGGTGAACAAGTGTGAGATCGCCAGGTTCTACAAGCTGCACGAGCGGAGGTGTGAGCCCATTGCCATGACAGTGCCTCGAAAGTCGGACCTGTTCCAGGAGGACCTGTACCCACCCACCGCAGGGCCCGACCCTGCCCTCACGGCTGAGGAGTGGCTGGGGGGTCGGGATGCTGGGCCCCTCCTCATCTCCCTCAAGGATGGCTACGTACCCCCAAAGAGCCGGGAGCTGAGGGTCAACCGGGGCCTGGACACCGGGCGCAGGAGGGCAGCACCAGAGGCCAGTGGCACTCCCAGCTCGGATGCCGTGTCTCGGCTGGAGGAGGAGATGCGGAAGCTCCAGGCCACGGTGCAGGAGCTCCAGAAGCGCTTGGACAGGCTGGAGGAGACAGTCCAGGCCAAGTAGAGCCCCGCAGGGCCTCCAGCAGGGTCAGCCATTCACACCCATCCACTCACCTCCCATTCCCAGCCACATGGCAGAGAAAAAAATCATAATAAAATGGCTTTATTTTCTGGTA