Transcript asmbl_51219

Sequence
Transcript Sequence for observation asmbl_51219 of TGE0059637:
TTCCTCCTCTTCCTCCTCCTCCTCCACCTCCGGCTTTTGGGGGATCACTGTCCTCTCTCGGCAGCAGAATGAGCCGGCAGGTGGTCCGCTCCAGCAAGTTCCGCCACGTGTTTGGACAGCCGGCCAAGGCCGACCAGTGCTATGAAGATGTGCGCGTCTCACAGACCACCTGGGACAGTGGCTTCTGTGCTGTCAACCCTAAGTTTGTGGCCCTGATCTGTGAGGCCAGCGGGGGAGGGGCCTTCCTGGTGCTGCCCCTGGGCAAGACTGGACGTGTGGACAAGAATGCGCCCACGGTCTGTGGCCACACAGCCCCTGTGCTAGACATCGCCTGGTGCCCGCACAATGACAACGTCATTGCCAGTGGCTCCGAGGACTGCACAGTCATGGTGTGGGAGATCCCAGATGGGGGCCTGATGCTGCCCCTGCGGGAGCCCGTCGTCACCCTGGAGGGCCACACCAAGCGTGTGGGCATTGTGGCCTGGCACACCACAGCCCAGAACGTGCTGCTCAGTGCAGGTTGTGACAACGTGATCATGGTGTGGGACGTGGGCACTGGGGCGGCCATGCTGACACTGGGCCCAGAGGTGCACCCAGACACGATCTACAGTGTGGACTGGAGCCGAGATGGAGGCCTCATTTGTACCTCCTGCCGTGACAAGCGCGTGCGCATCATCGAGCCCCGCAAAGGCACTGTCGTAGCTGAGAAGGACCGTCCCCACGAGGGGACCCGGCCCGTGCGTGCAGTGTTCGTGTCGGAGGGGAAGATCCTGACCACGGGCTTCAGCCGCATGAGTGAGCGGCAGGTGGCGCTGTGGGACACAAAGCACCTGGAGGAGCCGCTGTCCCTGCAGGAGCTGGACACCAGCAGCGGTGTCCTGCTGCCCTTCTTTGACCCTGACACCAACATCGTCTACCTCTGTGGCAAGGGTGACAGCTCAATCCGGTACTTTGAGATCACTTCCGAGGCCCCTTTCCTGCACTATCTCTCCATGTTCAGTTCCAAGGAGTCCCAGCGGGGCATGGGCTACATGCCCAAACGTGGCCTGGAGGTGAACAAGTGTGAGATCGCCAGGTTCTACAAGCTGCACGAGCGGAGGTGTGAGCCCATTGCCATGACAGTGCCTCGAAAGTCGGACCTGTTCCAGGAGGACCTGTACCCACCCACCGCAGGGCCCGACCCTGCCCTCACGGCTGAGGAGTGGCTGGGGGGTCGGGATGCTGGGCCCCTCCTCATCTCCCTCAAGGATGGCTACGTACCCCCAAAGAGCCGGGAGCTGAGGGTCAACCGGGGCCTGGACACCGGGCGCAGGAGGGCAGCACCAGAGGCCAGTGGCACTCCCAGCTCGGATGCCGTGTCTCGGCTGGAGGAGGAGATGCGGAAGCTCCAGGCCACGGTGCAGGAGCTCCAGAAGCGCTTGGACAGGCTGGAGGAGACAGTCCAGGCCAAGTAGAGCCCCGCAGGGCCTCCAGCAGGGTCAGCCATTCACACCCATCCACTCACCTCCCATTCCCAGCCACATGGCAGAGAAAAAAATCATAATAAAATGGCTTTATTTTCTGGTA