Transcript asmbl_51217

Sequence
Transcript Sequence for observation asmbl_51217 of TGE0059636:
TTCCTCCTCTTCCTCCTCCTCCTCCACCTCCGGCTTTTGGGGGATCACTGTCCTCTCTCGGCAGCAGAATGAGCCGGCAGGTGGTCCGCTCCAGCAAGTTCCGCCACGTGTTTGGACAGCCGGCCAAGGCCGACCAGTGCTATGAAGATGTGCGCGTCTCACAGACCACCTGGGACAGTGGCTTCTGTGCTGTCAACCCTAAGTTTGTGGCCCTGATCTGTGAGGCCAGCGGGGGAGGGGCCTTCCTGGTGCTGCCCCTGGGCAAGGTGAGCCCCTGGGGCCCTGGGGGGAGCAGCTCCTCCACCGGACCCATGGCTCTGTGCAGGTCCTGATTAGGTGACGGTCACCAGGCCTTCCAGGGCCTGTGTTGCCATCTGGAAAACTGAGCTGGGCCCCATGAGCCTTACACTTCCTCCAGCTCCTCTGTGCTGTGGCTGTGTGGAAACTGACGCTCAGAAGGAGCCAACACAAGATGGGTCACACCAGTGACCAGGACTACAGACAGTCCTGCAGACCCATGATCAGCCCTCCTGAGCCTCAGCCTGGGGCTTTCTCCCCATGGAAACACAGAGGGGGTTGGGATGGGGTCTGGGGGCCCTGGCAGCGTTCTCAGGGTTGGGAGGGACTCTGGCTCTGGGCCTGTCTGAGGACCTAGCAACTCTGTCCCCCAGCTCGCAGGCAGGGATGATGCAAGAGGTGCTCTCCCCCACCCGCAGCCCTGCCCTCCCCTGGAGCCTGCTGCCCCCTCCGCTGGCTGGCTGCTGCCCCGCACCCCCAGCACACTCCTGTGCTCTTTGGGGGGTAAGACAGGAAGGGGAGATGGGCCCCAAGTTGTTACCTTAAAAGGGCTGATGGAAGCAAAGAGAAGAGGAAGTGGTTGTCGGGGTGAGAGCTGGGCCCGCGCCCCACATGGCTGTCACACAGGAAGCCCTGCTGAAGCAGCTGTCCCCGGAAGAAGCCATTTCCAAACCTCTGCTCCTGCCTGGGGCCAGTTGGGACAGGCTCCCTGGCCCCTCTCCTTTTGGGAGGACCCACCCCTGCAGCCCCACCACTCACACTCGCTCTCTGGGGAGCTGCCTCCACCCCCCCAGCCCCCATACACCTGTCCTGGCTCCAGGGCCAGTTGTGCCCATGGAAGCCTCACTCGGGGAAGCTGGGGTGGGGGTGCCAACCCTAAGGGCAGAGACAGACTGAGACAGAGACCGGCGGGAACTCTGCCAGGGTCTTGCACGGCCCCCAACCTCTGCCATGCGTGGCCAGCCCTCCTGGGGTTTGCCCAGGCCATTTTGGGACTGGAACAAGAGAAGAACAACCCGCCCCCGTCCCCACCCCAGGCCCTGGTCCAGCTCCCAGGGACACCACAGCTTTCCTCTCTGGGCCTCTCTGAAGGAGGTGTGGGGAGGTTGGATTGGGTTTGGGAGGCAAAAGCACCTCCAAGGCCCTGCTGTGCCTTTAGACTGGACGTGTGGACAAGAATGCGCCCACGGTCTGTGGCCACACAGCCCCTGTGCTAGACATCGCCTGGTGCCCGCACAATGACAACGTCATTGCCAGTGGCTCCGAGGACTGCACAGTCATGGTGTGGGAGATCCCAGATGGGGGCCTGATGCTGCCCCTGCGGGAGCCCGTCGTCACCCTGGAGGGCCACACCAAGCGTGTGGGCATTGTGGCCTGGCACACCACAGCCCAGAACGTGCTGCTCAGTGCAGGTGCTGCGGGAGGAGGGGCTTGGGGGTGGCTCGTGGCCTGCAGTGGATGAGGGCAGGAGGCTCATGGCTTCTGACACTGTGGGGAACGTGCAGGTTGTGACAACGTGATCATGGTGTGGGACGTGGGCACTGGGGCGGCCATGCTGACACTGGGCCCAGAGGTGCACCCAGACACGATCTACAGTGTGGACTGGAGCCGAGATGGAGGCCTCATTTGTACCTCCTGCCGTGACAAGCGCGTGCGCATCATCGAGCCCCGCAAAGGCACTGTCGTAGCTGAGAAGGACCGTCCCCACGAGGGGACCCGGCCCGTGCGTGCAGTGTTCGTGTCGGAGGGGAAGATCCTGACCACGGGCTTCAGCCGCATGAGTGAGCGGCAGGTGGCGCTGTGGGACACAAAGCACCTGGAGGAGCCGCTGTCCCTGCAGGAGCTGGACACCAGCAGCGGTGTCCTGCTGCCCTTCTTTGACCCTGACACCAACATCGTCTACCTCTGTGGCAAGGGTGACAGCTCAATCCGGTACTTTGAGATCACTTCCGAGGCCCCTTTCCTGCACTATCTCTCCATGTTCAGTTCCAAGGAGTCCCAGCGGGGCATGGGCTACATGCCCAAACGTGGCCTGGAGGTGAACAAGTGTGAGATCGCCAGGTTCTACAAGCTGCACGAGCGGAGGTGTGAGCCCATTGCCATGACAGTGCCTCGAAAGTCGGACCTGTTCCAGGAGGACCTGTACCCACCCACCGCAGGGCCCGACCCTGCCCTCACGGCTGAGGAGTGGCTGGGGGGTCGGGATGCTGGGCCCCTCCTCATCTCCCTCAAGGATGGCTACGTACCCCCAAAGAGCCGGGAGCTGAGGGTCAACCGGGGCCTGGACACCGGGCGCAGGAGGGCAGCACCAGAGGCCAGTGGCACTCCCAGCTCGGATGCCGTGTCTCGGCTGGAGGAGGAGATGCGGAAGCTCCAGGCCACGGTGCAGGAGCTCCAGAAGCGCTTGGACAGGCTGGAGGAGACAGTCCAGGCCAAGTAGAGCCCCGCAGGGCCTCCAGCAGGGTCAGCCATTCACACCCATCCACTCACCTCCCATTCCCAGCCACATGGCAGAGAAAAAAATCATAATAAAATGGCTTTATTTTCTGGTA