Transcript asmbl_51214

Sequence
Transcript Sequence for observation asmbl_51214 of TGE0000592:
CCGCCTGCCCGCCTCCTGCGCCGCCCCTTCCGAGGCTAAATCGGCTGCGTTCCTCTCGGAACGCGCCGCAGAAGGGGTCCTGGTGACGAGTCCCGCGTTCTCTCCTTGAATCCACTCGCCAGCCCGCCGCCCTCTGCCGCCGCACCCTGCACACCCGCCCCTCTCCTGTGCCAGGAACTTGCTACTACCAGCACCATGCCCTACCAATATCCAGCACTGACCCCGGAGCAGAAGAAGGAGCTGTCTGACATCGCTCACCGCATCGTGGCACCTGGCAAGGGCATCCTGGCTGCAGATGAGTCCACTGGGAGCATTGCCAAGCGGCTGCAGTCCATTGGCACCGAGAACACCGAGGAGAACCGGCGCTTCTACCGCCAGCTGCTGCTGACAGCTGACGACCGCGTGAACCCCTGCATTGGGGGTGTCATCCTCTTCCATGAGACACTCTACCAGAAGGCGGATGATGGGCGTCCCTTCCCCCAAGTTATCAAATCCAAGGGCGGTGTTGTGGGCATCAAGGTAGACAAGGGCGTGGTCCCCCTGGCAGGGACAAATGGCGAGACTACCACCCAAGGGTTGGATGGGCTGTCTGAGCGCTGTGCCCAGTACAAGAAGGACGGAGCTGACTTCGCCAAGTGGCGTTGTGTGCTGAAGATTGGGGAACACACCCCCTCAGCCCTCGCCATCATGGAAAATGCCAATGTTCTGGCCCGTTATGCCAGTATCTGCCAGCAGAATGGCATTGTGCCCATCGTGGAGCCTGAGATCCTCCCTGATGGGGACCATGACTTGAAGCGCTGCCAGTATGTGACCGAGAAGGTGCTGGCTGCTGTCTACAAGGCTCTGAGTGACCACCACATCTACCTGGAAGGCACCTTGCTGAAGCCCAACATGGTCACCCCAGGCCATGCTTGCACTCAGAAGTTTTCTCATGAGGAGATTGCCATGGCGACCGTCACAGCGCTGCGCCGCACAGTGCCCCCCGCTGTCACTGGGATCACCTTCCTGTCTGGAGGCCAGAGTGAGGAGGAGGCGTCCATCAACCTCAATGCCATTAACAAGTGCCCCCTGCTGAAGCCCTGGGCCCTGACCTTCTCCTACGGCCGAGCCCTGCAGGCCTCTGCCCTGAAGGCCTGGGGCGGGAAGAAGGAGAACCTGAAGGCTGCGCAGGAGGAGTATGTCAAGCGAGCCCTGGCCAACAGCCTTGCCTGTCAAGGAAAGTACACTCCGAGCGGTCAGGCTGGGGCTGCTGCCAGCGAGTCCCTCTTCGTCTCTAACCACGCCTATTAAGCGGAGGTGTTCCCAGGCTGCCCCCAACACTCCAGGCCCTGCCCCCTCCCACTCTTGAAGAGGAGGCCGCCTCCTCGGGGCTCCAGGCTGGCTTGCCCGCGCTCTTTCTTCCCTCGTGACAGTGGTGTGTGGTGTCGTCTGTGAATGCTAAGTCCATCACCCTTTCCGGCACACTGCCAAATAAACAGCTATTTAAGGGGGAGTCGGCCGTCCGTGTCTTGTGGTGT