Transcript asmbl_51213

Sequence
Transcript Sequence for observation asmbl_51213 of TGE0000592:
TCTGCGACTGTGCCTGTACGTGCCAGCTCCCCGACTGCCAGAGCCTCAACTGTCTCTGCTTCGAGATCAAGCTCCGATGAGGACCCAGGGCCCCTGCCCTCTGGGGAGCGGCCAGCCCCCAGGGCCCATGTGCCCTCCTCCCTGAAGAGCCTTTCCCCACGCCACTGGAACCACAGATGGCCTGCCGAGCACCCAGGCCTGGGAACTGGAAGTGGCAGCGCAGGGCCTGGCTCCCTGCAGGGCAGGACTCTTGGCCGGCTGGACGGCAGCTCCTCTGGAGGGCCAGAAAAGAGAGGGGCTAGTGCTCGGGCAGGTGCCCTGGCTTCCCTTCCCCTCCACACGTCAACGATTCTATTTGAAGTTGGGCAGGGGGGTGGCGCTGCTCACCACACACAAGTGTTATAGGAGGAGTCTGGCCCTTGAGTACCGGGTACGCAGGGGTGCCTCAACCACACTCCGTCCACGGACTCTCCGTTATTTTAGGAGGTCCCTGGCCAAAGATTTATTTCTCTTGACAACCAAGGGCCTCCGTCTGGATTTCCAAGGAAGAATTTCCTCTGAAGCACCGGAACTTGCTACTACCAGCACCATGCCCTACCAATATCCAGCACTGACCCCGGAGCAGAAGAAGGAGCTGTCTGACATCGCTCACCGCATCGTGGCACCTGGCAAGGGCATCCTGGCTGCAGATGAGTCCACTGGGAGCATTGCCAAGCGGCTGCAGTCCATTGGCACCGAGAACACCGAGGAGAACCGGCGCTTCTACCGCCAGCTGCTGCTGACAGCTGACGACCGCGTGAACCCCTGCATTGGGGGTGTCATCCTCTTCCATGAGACACTCTACCAGAAGGCGGATGATGGGCGTCCCTTCCCCCAAGTTATCAAATCCAAGGGCGGTGTTGTGGGCATCAAGGTAGACAAGGGCGTGGTCCCCCTGGCAGGGACAAATGGCGAGACTACCACCCAAGGGTTGGATGGGCTGTCTGAGCGCTGTGCCCAGTACAAGAAGGACGGAGCTGACTTCGCCAAGTGGCGTTGTGTGCTGAAGATTGGGGAACACACCCCCTCAGCCCTCGCCATCATGGAAAATGCCAATGTTCTGGCCCGTTATGCCAGTATCTGCCAGCAGAATGGCATTGTGCCCATCGTGGAGCCTGAGATCCTCCCTGATGGGGACCATGACTTGAAGCGCTGCCAGTATGTGACCGAGAAGGTGCTGGCTGCTGTCTACAAGGCTCTGAGTGACCACCACATCTACCTGGAAGGCACCTTGCTGAAGCCCAACATGGTCACCCCAGGCCATGCTTGCACTCAGAAGTTTTCTCATGAGGAGATTGCCATGGCGACCGTCACAGCGCTGCGCCGCACAGTGCCCCCCGCTGTCACTGGGATCACCTTCCTGTCTGGAGGCCAGAGTGAGGAGGAGGCGTCCATCAACCTCAATGCCATTAACAAGTGCCCCCTGCTGAAGCCCTGGGCCCTGACCTTCTCCTACGGCCGAGCCCTGCAGGCCTCTGCCCTGAAGGCCTGGGGCGGGAAGAAGGAGAACCTGAAGGCTGCGCAGGAGGAGTATGTCAAGCGAGCCCTGGCCAACAGCCTTGCCTGTCAAGGAAAGTACACTCCGAGCGGTCAGGCTGGGGCTGCTGCCAGCGAGTCCCTCTTCGTCTCTAACCACGCCTATTAAGCGGAGGTGTTCCCAGGCTGCCCCCAACACTCCAGGCCCTGCCCCCTCCCACTCTTGAAGAGGAGGCCGCCTCCTCGGGGCTCCAGGCTGGCTTGCCCGCGCTCTTTCTTCCCTCGTGACAGTGGTGTGTGGTGTCGTCTGTGAATGCTAAGTCCATCACCCTTTCCGGCACACTGCCAAATAAACAGCTATTTAAGGGGGAGTCGGCCGTCCGTGTCTTGTGGTGT