Transcript asmbl_50380

Sequence
Transcript Sequence for observation asmbl_50380 of TGE0000530:
CGCACGCGCGTCGGAGGCGAAGGAGGAACCCACCGCACCTACAGGGCGGTCGAGTGAGGGAGCTGCTGGCGGGTGGGTCTGGCAACTCTTTGGGAGGCCGACGCGGGCGGACCGGCGGGTGCTGGGAACCGAGCCTCGGCTTGCGGCCGGCAGTTTCCGTGGGTCTGTGAAGAGGTCGGCGGCCCCTGCGGGCGCCAGTCAGCTTTAAGAAAAAGTAGAGATCACTTCTGACTGTACTGAACAGCAAAAATTAAGTGACTTGCTGCCCTGCACATCATGGCACTGCCATTCCGTAAGGACTTAGAAAAGTACAAAGACCTTGATGAAGATGAGCTCCTTGGGAATCTGTCAGAAACAGAACTGAAACAACTGGAAACTGTTTTGGATGATCTTGACCCCGAGAATGCCCTTCTGCCTGCAGGGTTCCGGCAGAAGAACCAGACATCAAAGTCCACCACAGGGCCATTTGATAGAGAGCATCTCCTTTCATATCTGGAGAAAGAAGCATTGGAGCATAAAGACAGGGAAGACTATGTGCCCTACACTGGAGAAAAAAAAGGGAAAATATTTATCCCCAAACAGAAACCTGTACAGACTTTTACAGAAGAAAAAGTGTCTCTTGATCCAGAATTAGAAGAAGCTTTGACAAGTGCTTCTGATACAGAATTGTGTGACCTCGCAGCAATTCTTGGGATGCACAATTTGATAACGAATACAAAGTTCTGTAATATAATGGGAAGTAGTAATGGTGTTGACCAAGAACATTTTTCAAATGTGGTCAAAGGTGAAAAGATTCTTCCGGTATTTGATGAGCCACCAAATCCAACCAATGTAGAAGAGAGTTTGAAGAGAACTAAAGAAAACGATGCTCATCTTGTTGAAGTTAATTTGAATAATATAAAGAATATCCCAATTCCAACCCTAAAAGATTTTGCAAAGGCTTTGGAAACCAACACACATGTGAAATGTTTCAGTCTTGCAGCCACCCGGAGCAATGACCCTGTTGCTACTGCTTTTGCAGAAATGCTGAAAGTGAACAAAACTTTGAAGAGCTTAAATGTGGAGTCCAACTTTATCACGGGAGTTGGGATTCTGGCACTGATTGATGCGTTAAGAGATAATGAAACCCTGGCAGAGCTCAAGATTGACAATCAGAGGCAGCAGTTGGGGACAGCTGTAGAATTGGAAATGGCCAAGATGCTTGAGGAAAATACAAATATCCTTAAATTTGGATATCAGTTTACACAGCAGGGACCACGAACCAGAGCAGCTAATGCTATAACAAAAAACAATGACTTAGTGCGTAAGAGACGAGTTGAAGGAGATCACCAGTAAGTCTGCAAAGGTGTAATCTTTGGAAGACTTCAGAAGATCACCAAGGGCTCATGTTGGTGACATCATGTAAAATTTTCCTGGGTAGAAGGGAAAAGACTGGAAAAATTTTTTTAGTGACATGCATTTTTTTTTTAGTTGTTATCAAATTGTAAAATCAGTAATGTGATATTTTATATTCTGAAACATTTCTACTTTCTGCTAAAATCAATTTTAATTTAGTTTAATTGAATGATTTATGATGAATCTTGGGCAAAAAAATACAACTGTAAAAAATTTCACAGGTCATTTGTGTAGAATAATTTGAACATTGTGAGGACCAATCTTTTTTAAATCAAAAGGGATGTTGCTGGTATCAGAATTGTTATTGCTTCATTTAGACATAAAACACTTAAGTGTTTTCTTCACTCCGTGACCTGGAGAGTTTTCCATTTTTTAAAATACATGAACTTGGCAAGGGTGTGATTTTTCTTTATCAAGAGAACAAAATGCCAGAATGTTAAAACAGTTAACTCAAAATCTAGTCATCTGTGTAGGAGCTAAAGCAGGTCTCCAGGGAGAGAGGGTGGTCGTCTGTGCATTCCAGGTTACTGCACTTGTCTGATGTGACGTAGCAACACCCAGGTCTTCTTAAAACAAAGTCATCAGCTTTGCCAGGTTACATACTTTATTTAAAAGTATAGTGAGGTCGAAGTTCATTCCAGTGTTTCATTTTAATAATGTGGGCATTATTAAATTTTTGTGGAAGCTAATAGTAAAAAATAAAAGCTGTTTTCACCACCTCCCTCCCCACCCCCCAAAAAAGGCGTACAGCCAACTCTTAGTTATTTAGGGTAAGAGAAAAAAGAAAACTGTTAAACAATGAAATCAAAGATAATAAATATGATAGATTTCCAGTATGAGGCACTTGCAAAACAGTCATTTAAACTGATGGTTACTGTAAGTCAGTTGGAAGCTGGCATGTATGTAAATTACTTGGTGTTACACCATATCCGAAGAAGTTCCTATGTGCAGTGCAGAATTGCATAAACAGTATTTAATCACTGCTACAAATCTTCCAACCAAGAAGGAAAACTGCTATTCTTCATAAATCTAATTTTTAGTATATGCTTCCTTTCATCTTATACTTTTATCAATATTTATAAAAGTCATTTCTATAATAAAAGCAGTCTTTCTTGCTCAAAGTATTAAGGTGAACAATTGAATAGAGTACTGTGGTCGGGAGACTGATTTGAGACTGCAGAGCTGATGCTGGGTAGAGGGTCTGGACTTGTATTCATGTTCTGTCTCAGGGCAGCCCCTGGAGCAGGAGATGGCAGAGGCATTTACAGCTGCAGAAAACAGGGAGGAATGGAATCTGAGGTAGCCCTGGCCTCAAAATTCAGGCCTGGCTGTATCATTTACAGAGATTTTTCTGGAGGGAAAAGTCTCATTTCTGAGGAAGGCAAGGTGGCTAATCATTATTAATTTTTTTTAAACTTTTTGGGCCGGGCGCAGTGGCTC