Transcript asmbl_49913

Sequence
Transcript Sequence for observation asmbl_49913 of TGE0057031:
CCCAAGCCGGGTTTGGGGGTTGGGACCTCCGGCTGCAGGTCCGCCTGGGCCAGACGCGCGAGCGCAAGCAGCGGGTTAGTGGTCGCGCGCCCGACCTCCGCAGTCCCAGCCGAGCCGCGACCCTTCCGGCCGTCCCCACCCCACCTCGCCGCCATGCGCCTCCGCCGCCTAGCGCTGTTCCCGGGTGTGGCGCTGCTTCTTGCCGCGGCCCGCCTCGCCGCTGCCTCCGACGTGCTAGAACTCACGGACGACAACTTCGAGAGTCGCATCTCCGACACGGGCTCTGCGGGCCTCATGCTCGTCGAGTTCTTCGCCCCCTGGTGTGGACACTGCAAGAGACTTGCACCTGAGTATGAAGCTGCAGCTACCAGATTAAAAGGAATAGTCCCATTAGCAAAGGTTGATTGCACTGCCAACACTAACACCTGTAATAAATATGGAGTCAGTGGATATCCAACCCTGAAGATATTTAGAGATGGTGAAGAAGCAGGTGCTTATGATGGACCTAGGACTGCTGATGGAATTGTCAGCCACTTGAAGAAGCAGGCAGGACCAGCTTCAGTGCCTCTCAGGACTGAGGAAGAATTTAAGAAATTCATTAGTGATAAAGATGCCTCTATAGTAGGTTTTTTCGATGATTCATTCAGTGAGGCTCACTCCGAGTTCCTAAAAGCAGCCAGCAACTTGAGGGATAACTACCGATTTGCACATACGAATGTTGAGTCTCTGGTGAACGAGTATGATGATAATGGAGAGGGTATCATCTTATTTCGTCCTTCACATCTCACTAACAAGTTTGAGGACAAGACTGTGGCATATACAGAGCAAAAAATGACCAGTGGCAAAATTAAAAAGTTTATCCAGGAAAACATTTTTGGTATCTGCCCTCACATGACAGAAGACAATAAAGATTTGATACAGGGCAAGGACTTACTTATTGCTTACTATGATGTGGACTATGAAAAGAACGCTAAAGGTTCCAACTACTGGAGAAACAGGGTAATGATGGTGGCAAAGAAATTCCTGGATGCTGGGCACAAACTCAACTTTGCTGTAGCTAGCCGCAAAACCTTTAGCCATGAACTTTCTGATTTTGGCTTGGAGAGCACTGCTGGAGAGATTCCTGTTGTTGCTATCAGAACTGCTAAAGGAGAGAAGTTTGTCATGCAGGAGGAGTTCTCGCGTGATGGGAAGGCTCTGGAGAGGTTCCTGCAGGATTACTTTGATGGCAATCTGAAGAGATACCTGAAGTCTGAACCTATCCCAGAGAGCAATGATGGGCCTGTGAAGGTAGTGGTAGCAGAGAATTTTGATGAAATAGTGAATAATGAAAATAAAGATGTGCTGATTGAATTTTATGCCCCTTGGTGTGGTCACTGTAAGAACCTGGAGCCCAAGTATAAAGAACTTGGCGAGAAGCTCAGCAAAGACCCAAATATCGTCATAGCCAAGATGGATGCCACAGCCAATGATGTGCCTTCTCCATATGAAGTCAGAGGTTTTCCTACCATATACTTCTCTCCAGCCAACAAGAAGCTAAATCCAAAGAAATATGAAGGTGGCCGTGAATTAAGTGATTTTATTAGCTATCTACAAAGAGAAGCTACAAACCCCCCTGTAATTCAAGAAGAAAAACCCAAGAAGAAGAAGAAGGCACAGGAGGATCTCTAAAGCAGTAGCCAAACACCACTTTGTAAAAGGACTCTTCCATCAGAGATGGGAAAACCATTGGGGAGGACTAGGACCCATATGGGAATTATTACCTCTCAGGGCCGAGAGGACAGAATGGATATAATCTGAATCCTGTTAAATTTTCTCTAAACTGTTTCTTAGCTGCACTGTTTATGGAAATACCAGGACCAGTTTATGTTTGTGGTTTTGGGAAAAATTATTTGTGTTGGGGGAAATGTTGTGGGGGTGGGGTTGAGTTGGGGGTATTTTCTAATTTTTTTTGTACATTTGGAACAGTGACAATAAATGAGACCCCTTTAAACTGTCTTATTTTCCACCAGATTGAGAACCAGATGTTCTCTACACACTATCACTGTTCAATAGAGCTTTCTTCAGTGATGGAAATGCTCTGTAATCTACACTGTTCAGTACAGGTAGCTACGGAGCATCTGAAATATGGCTAGAAACTACATTTTTGTTTTGATTAATTTAAATAGCCATACAGTTGCTACCATACTGGTCACGGCAGCTGTAGACTGACTGGGTCCATAGTTCATCACCTCAAAATTCTTTCAAAATTTATTATCTCTTTCTCTCCTTACATGTTTATTTCCCAGGCCTACCCTGGTGATTAGAACAGCTGAAGGGCCTTTCTTGTTAGGCTGTCCATGCCCTAAGGATGGGTTCCTGTTTATCCTTGCCACGCAGCTGAGCTTACTGCATGTTTATATCTCCCAAGGACTGTTCTCTGCTCAGAAATGCCCTGTCAAGGGTGTGGCATCACGCAGTTTCATCCAAGTTGTTTCAGGAATTGCTGACACTGCTGGGTGCAGTTCTATCCCCTAAAGCCTAGGGTGTGGCCCTTTAACTTCCCCTTCAGTAGAACTGGGAAAGGCAGTACCATTCCTAGTTATGAGTGAAGCATCCACTTTCTTTTGTAACAATGAGGAACAGAAAGGATAAGACTGAAGAGTGATCTTTTGTCCAACTAAACCATTTATCTCCTTTTGTAGGTAAATTCAAATCCTGCCCAGTTATAGTTTTCAGTCACTGGAGAATTCCAGGTAGGAGCCCTACTTTAGGTGATCCTAGGAACTCCTATGTTCAGAAAAGAATTTTCTTCCTACTATATAATTACAGTATTTAGCTGTCAATTTTAAGATGAATTTGGTAGAGCCTTATAGTAAAGTATGTATCTTGGTCACACACAAAGCTTGGAAAAAGTAAAAGATGTCTAAACCATAATCTTGTAACTCATAACATCTGGGCTGGGGCCCGGGGATCTAATTGTTTAGAGAGCCCCAAAAGTGGCTCAGATGTAAAGCCAGGGTTAAGAACCATCTGCCTTGGAAGATTTAAGGGAAACATATAAACTTGTACAAAGGACACAGAAGCAGTCAGTTTTAATTTTTTAGCCATGTTGGTAAAAGTTCATTTTCAGTACATGGGTAACACCCAGGCCCTTTCCCATTATATCCAGGTATGCTACAAGTTCTTTTAACTCTTATCAGAAGTTATTATTACTGTTTCCTTAGAGAGGCTACCAGGCTAAAATTCACTTAGTTTGGTTTGTCTAATGTCCTCATTATTTTATCCTGAAGATGATGTCATTTCTCAGGACTTGAAAATGACTTGGCTGAACTAAAGGTAAAAAAGCCAAGCCTCTGTCACTTTTCCTAGACTCCTAGGCACAGCTATGGAGTCTTTGCACAGTGCCCATACCCTAAAAATTAATAATGAAAACCAAACCTCAAGAACCTAGAGCAGCTCTCTACTTGCCACCATGGACTCCAGTGGTCAGCATAAGAAAAGCAGATAGTTGCATTCTATTTAGTTTATAGCTGCTTTGTTCCTTTGTGTTTCACTAAGCAGAGGCTCAAAAATTCCCTTGATAACTTCAGCTGCCCCTGTTCTTTTCCTCAAACTCCAGGATGAGACCTTTAATGTGGGACAATTTCTGGTGAAGGTACTCACAGCGACGCTTTTCTTCTCTGTAACTTGGGTACTGCTGCAGAGAAAAAGCATCCATGTCAAAAAGTAAAAATTCTCATTCTACCTTGCTTCCGTTCCCAGACCTTGTCTTACCTTCCTGAACTTTTTATATTCCTG