Transcript asmbl_49406

Sequence
Transcript Sequence for observation asmbl_49406 of TGE0059635:
TCAGCCTGCTGAACAGTTCCTTTTTCAGAGACATAGATACCATCCAAAAATTTCCTGATATCCTTGTTTTTAACTGTTGTGGCTTGCTGAATCAAAGCCGCTGAATTTGAAACAAGCTCAATGTCATTTCCTTCAAGGATTAATTCATCTTTCTGGGCTTGAGATACTGAACAAGCAACACCTGGTCTCATCCGAACCCTGCGGATGTATTTTTCACCCAAGAAATTTCGGATTTCAACAAGAGACCCATTCTCCTGGATAACAACGTTGATGGGGAAGTGAGCATACACAGACCTCATCTTGTAACGGAAGCCCAGTGTAACACCCTTGATCATGTTCTGTACATGACTACAAATAGTCCGAACGGTAGCCAGTTCCTTTCTGTTACCCCACCATTTGTCAACCCGGAGCCTCTTTTTTTTCTTTCCAAGAAGGCTGAGTTCTACATTGATGTGATTGAAGTCCCTCCGCAGGGTTCCTCTGGGGCC