Transcript asmbl_46385

Sequence
Transcript Sequence for observation asmbl_46385 of TGE0059634:
GGACCCGCCAACATGGTAGGTGTTTTGGCTCGAGGCCGCCATCCTCCACAATCGTCCCCCATCTGCAGCTTCCCGCGGTCCTCAGCCCACAGAGAGGCCCTGGGCCGGGAAGGCGCAGAGCCCTGTCAGGCTGGAGCGCAACGGGCCGGCGGCTTCCGCATTAAGCCCGGCGCCCGGCACTGTTTAGCCGGGCCCTCTCCGGCTCAGCGCAGCCGGCGGTCCCCAACCACACCGGCCGGGGCTCGGCGCCGCACTCTTCCCAGAAGGTTGCGCTGGCTCGTGAGTGATCCTGTCCTCTCCACCCGCAGGGCCGCGTTCGCACCAAAACCGTGAAGAAGGCGGCCCGGGTCATCATAGAAAAGTACTACACGCGCCTGGGCAACGACTTCCACACGAACAAGCGCGTGTGCGAGGAGATCGCCATTATCCCCAGCAAAAAGCTCCGCAACAAGATAGCAGGTTATGTCACGCATCTGATGAAGCGAATTCAGAGAGGCCCAGTAAGAGGTATCTCCATCAAGCTGCAGGAGGAGGAGAGAGAAAGGAGAGACAATTATGTTCCTGAGGTCTCAGCCTTGGATCAGGAGATTATTGAAGTAGATCCTGACACTAAGGAAATGCTGAAGCTTTTGGACTTCGGCAGTCTGTCCAACCTTCAGGTCACTCAGCCTACAGTTGGGATGAATTTCAAAACGCCTCGGGGACCTGTTTGAATTTTTTCTGTAGTGCTGTATTATTTTCAATAAATCTGGGACAACAGCC