Transcript asmbl_46283

Sequence
Transcript Sequence for observation asmbl_46283 of TGE0056234:
GGAATACTAAGTCCTCTGAGCCTGGATCTCCTTCAGCTCTGCCACCTACCTCCTTGTTTGCTAAATGTCCTTAGAGAAGTTAGGATATGCCTGGGGAACCCTGGGTCATATAACCATGACAACTGGCTGACCCTGTTGTCTCTCCCTCTCTGCCCTCCTCTAGCTGGGAGGTGGAAGCAGCATTGCCCAAGCCTCCCAGGAGTGACAGGAATTGTTTCTGCCTGAGGAGACACTCTGCAGCCTGGGCTCTGTGAGACTGAGGTGGCGGTCAGCCGGACTTGAGGAGCGAGGATGGCAGTCAACAAAGGCCTCACCTTGCTGGATGGAGACCTCCCTGAGCAGGAGAATGTGCTGCAGCGGGTCCTGCAGCTGCCGGTGGTGAGTGGCACCTGCGAATGCTTCCAGAAGACCTACACCAGCACTAAGGAAGCCCACCCCCTGGTGGCCTCTGTGTGCAATGCCTATGAGAAGGGCGTGCAGAGCGCCAGTAGCTTGGCTGCCTGGAGCATGGAGCCGGTGGTCCGCAGGCTGTCCACCCAGTTCACAGCTGCCAATGAGCTGGCCTGCCGAGGCTTGGACCACCTGGAGGAAAAGATCCCCGCCCTCCAGTACCCCCCTGAAAAGATTGCTTCTGAGCTGAAGGACACCATCTCCACCCGCCTCCGCAGTGCCAGAAACAGCATCAGCGTTCCCATCGCGAGCACTTCAGACAAGGTCCTGGGGGCCGCTTTGGCCGGGTGCGAGCTTGCCTGGGGGGTGGCCAGAGACACTGCGGAATTTGCTGCCAACACTCGAGCTGGCCGACTGGCTTCTGGAGGGGCCGACTTGGCCTTGGGCAGCATTGAGAAGGTGGTGGAGTACCTCCTCCCTCCAGACAAGGAAGAGTCAGGTACCTGCCATTCGGAGGCTCGGCCTGGGAGTGAGTTGTCACACACACTGCCTGGGAATCAGCAGGAGGTGGCTCAACCAGCCACTGCTCTGGAATAGGGAAGGCCAGTGGGATTTTCAGATGGATTCATAATCATTTACCCCCCCCACCCCCACCCCATCTGTAAAGAGGGAAAGTGAGTTGTGGAACTCACCAGTGAGTTTGTGGTGGACCTAGAACACCTACTTTCCAGTCCTAGACATGACCCAGATCTCTCCGGCCCCTCTCTGACCTGTTTTCTCTTCTTTCCCCCCAAATCCCTACCCAGCCCCTGCTCCTGGACACCAGCAAGCCCAGAAGTCTCCCAAGGCCAAGCCAAGCCTCTTGAGCAGGGTTGGGGCTCTGACCAACACCCTCTCTCGATACACCGTGCAGACCATGGCCCGGGCCCTGGAGCAGGGCCACACCGTGGCCATGTGGATCCCAGGCGTGGTGCCCCTGAGCAGCCTGGCCCAGTGGGGTGCCTCAGTGGCCATGCAGGCGGTGTCCCGGCGGAGGAGCGAAGTGCGGGTACCCTGGCTGCACAGCCTCGCAGCCGCCCAGGAGGAGGATCATGAGGACCAGACAGACACGGAGGGAGAGGACACGGAGGAGGAGGAA