Transcript asmbl_46282

Sequence
Transcript Sequence for observation asmbl_46282 of TGE0056234:
GGAATACTAAGTCCTCTGAGCCTGGATCTCCTTCAGCTCTGCCACCTACCTCCTTGTTTGCTAAATGTCCTTAGAGAAGTTAGGATATGCCTGGGGAACCCTGGGTCATATAACCATGACAACTGGCTGACCCTGTTGTCTCTCCCTCTCTGCCCTCCTCTAGCTGGGAGGTGGAAGCAGCATTGCCCAAGCCTCCCAGGAGTGACAGGAATTGTTTCTGCCTGAGGAGACACTCTGCAGCCTGGGCTCTGTGAGACTGAGGTGGCGGTCAGCCGGAGTGAGTGTTGGGGTCCTGGGGCACCTGCCTTACATGGCTTGTTTATGAACATTAAAGGGAAGAAGTTGAAGCTTGAGGAGCGAGGATGGCAGTCAACAAAGGCCTCACCTTGCTGGATGGAGACCTCCCTGAGCAGGAGAATGTGCTGCAGCGGGTCCTGCAGCTGCCGGTGGTGAGTGGCACCTGCGAATGCTTCCAGAAGACCTACACCAGCACTAAGGAAGCCCACCCCCTGGTGGCCTCTGTGTGCAATGCCTATGAGAAGGGCGTGCAGAGCGCCAGTAGCTTGGCTGCCTGGAGCATGGAGCCGGTGGTCCGCAGGCTGTCCACCCAGTTCACAGCTGCCAATGAGCTGGCCTGCCGAGGCTTGGACCACCTGGAGGAAAAGATCCCCGCCCTCCAGTACCCCCCTGAAAAGATTGCTTCTGAGCTGAAGGACACCATCTCCACCCGCCTCCGCAGTGCCAGAAACAGCATCAGCGTTCCCATCGCGAGCACTTCAGACAAGGTCCTGGGGGCCGCTTTGGCCGGGTGCGAGCTTGCCTGGGGGGTGGCCAGAGACACTGCGGAATTTGCTGCCAACACTCGAGCTGGCCGACTGGCTTCTGGAGGGGCCGACTTGGCCTTGGGCAGCATTGAGAAGGTGGTGGAGTACCTCCTCCCTCCAGACAAGGAAGAGTCAGGTACCTGCCATTCGGAGGCTCGGCCTGGGAGTGAGTTGTCACACACACTGCCTGGGAATCAGCAGGAGGTGGCTCAACCAGCCACTGCTCTGGAATAGGGAAGGCCAGTGGGATTTTCAGATGGATTCATAATCATTTACCCCCCCCACCCCCACCCCATCTGTAAAGAGGGAAAGTGAGTTGTGGAACTCACCAGTGAGTTTGTGGTGGACCTAGAACACCTACTTTCCAGTCCTAGACATGACCCAGATCTCTCCGGCCCCTCTCTGACCTGTTTTCTCTTCTTTCCCCCCAAATCCCTACCCAGCCCCTGCTCCTGGACACCAGCAAGCCCAGAAGTCTCCCAAGGCCAAGCCAAGCCTCTTGAGCAGGGTTGGGGCTCTGACCAACACCCTCTCTCGATACACCGTGCAGACCATGGCCCGGGCCCTGGAGCAGGGCCACACCGTGGCCATGTGGATCCCAGGCGTGGTGCCCCTGAGCAGCCTGGCCCAGTGGGGTGCCTCAGTGGCCATGCAGGCGGTGTCCCGGCGGAGGAGCGAAGTGCGGGTACCCTGGCTGCACAGCCTCGCAGCCGCCCAGGAGGAGGATCATGAGGACCAGACAGACACGGAGGGAGAGGACACGGAGGAGGAGGAA