Transcript asmbl_46280

Sequence
Transcript Sequence for observation asmbl_46280 of TGE0056233:
GGAATACTAAGTCCTCTGAGCCTGGATCTCCTTCAGCTCTGCCACCTACCTCCTTGTTTGCTAAATGTCCTTAGAGAAGTTAGGATATGCCTGGGGAACCCTGGGTCATATAACCATGACAACTGGCTGACCCTGTTGTCTCTCCCTCTCTGCCCTCCTCTAGCTGGGAGGTGGAAGCAGCATTGCCCAAGCCTCCCAGGAGTGACAGGAATTGTTTCTGCCTGAGGAGACACTCTGCAGCCTGGGCTCTGTGAGACTGAGGTGGCGGTCAGCCGGAGTGAGTGTTGGGGTCCTGGGGCACCTGCCTTACATGGCTTGTTTATGAACATTAAAGGGAAGAAGTTGAAGCTTGAGGAGCGAGGATGGCAGTCAACAAAGGCCTCACCTTGCTGGATGGAGACCTCCCTGAGCAGGAGAATGTGCTGCAGCGGGTCCTGCAGCTGCCGGTGGTGAGTGGCACCTGCGAATGCTTCCAGAAGACCTACACCAGCACTAAGGAAGCCCACCCCCTGGTGGCCTCTGTGTGCAATGCCTATGAGAAGGGCGTGCAGAGCGCCAGTAGCTTGGCTGCCTGGAGCATGGAGCCGGTGGTCCGCAGGCTGTCCACCCAGTTCACAGCTGCCAATGAGCTGGCCTGCCGAGGCTTGGACCACCTGGAGGAAAAGATCCCCGCCCTCCAGTACCCCCCTGAAAAGATTGCTTCTGAGCTGAAGGACACCATCTCCACCCGCCTCCGCAGTGCCAGAAACAGCATCAGCGTTCCCATCGCGAGCACTTCAGACAAGGTCCTGGGGGCCGCTTTGGCCGGGTGCGAGCTTGCCTGGGGGGTGGCCAGAGACACTGCGGAATTTGCTGCCAACACTCGAGCTGGCCGACTGGCTTCTGGAGGGGCCGACTTGGCCTTGGGCAGCATTGAGAAGGTGGTGGAGTACCTCCTCCCTCCAGACAAGGAAGAGTCAGCCCCTGCTCCTGGACACCAGCAAGCCCAGAAGTCTCCCAAGGCCAAGCCAAGCCTCTTGAGCAGGGTTGGGGCTCTGACCAACACCCTCTCTCGATACACCGTGCAGACCATGGCCCGGGCCCTGGAGCAGGGCCACACCGTGGCCATGTGGATCCCAGGCGTGGTGCCCCTGAGCAGCCTGGCCCAGTGGGGTGCCTCAGTGGCCATGCAGGCGGTGTCCCGGCGGAGGAGCGAAGTGCGGGTACCCTGGCTGCACAGCCTCGCAGCCGCCCAGGAGGAGGATCATGAGGACCAGACAGACACGGAGGGAGAGGACACGGAGGAGGAGGAA