Transcript asmbl_46085

Sequence
Transcript Sequence for observation asmbl_46085 of TGE0058002:
GGGCGGGGCGGCGGAGGGATTGCGGCGGCCCGCAGCGGGATAACCTTGAGGCTGAGGCAGTGGCTCCTTGCACAGCAGCTGCACGCGCCGTGGCTCCGGATCTCTTCGTCTTTGCAGCGTAGCCCGAGTCGGTCAGCGCCGGAGGACCTCAGCAGCCATGTCGAAGCCCCATAGTGAAGCCGGGACTGCCTTCATTCAGACCCAGCAGCTGCACGCAGCCATGGCTGACACATTCCTGGAGCACATGTGCCGCCTGGACATTGATTCACCACCCATCACAGCCCGGAACACTGGCATCATCTGTACCATTGGCCCAGCTTCCCGATCAGTGGAGACGTTGAAGGAGATGATTAAGTCTGGAATGAATGTGGCTCGTCTGAACTTCTCTCATGGAACTCATGAGTACCATGCGGAGACCATCAAGAATGTGCGCACAGCCACGGAAAGCTTTGCTTCTGACCCCATCCTCTACCGGCCCGTTGCTGTGGCTCTAGACACTAAAGGACCTGAGATCCGAACTGGGCTCATCAAGGGCAGCGGCACTGCAGAGGTGGAGCTGAAGAAGGGAGCCACTCTCAAAATCACGCTGGATAACGCCTACATGGAAAAGTGTGACGAGAACATCCTGTGGCTGGACTACAAGAACATCTGCAAGGTGGTGGAAGTGGGCAGCAAGATCTACGTGGATGATGGGCTTATTTCTCTCCAGGTGAAGCAGAAAGGTGCCGACTTCCTGGTGACGGAGGTGGAAAATGGTGGCTCCTTGGGCAGCAAGAAGGGTGTGAACCTTCCTGGGGCTGCTGTGGACTTGCCTGCTGTGTCGGAGAAGGACATCCAGGATCTGAAGTTTGGGGTCGAGCAGGATGTTGATATGGTGTTTGCGTCATTCATCCGCAAGGCATCTGATGTCCATGAAGTTAGGAAGGTCCTGGGAGAGAAGGGAAAGAACATCAAGATTATCAGCAAAATCGAGAATCATGAGGGGGTTCGGAGGTTTGATGAAATCCTGGAGGCCAGTGATGGGATCATGGTGGCTCGTGGTGATCTAGGCATTGAGATTCCTGCAGAGAAGGTCTTCCTTGCTCAGAAGATGATGATTGGACGGTGCAACCGAGCTGGGAAGCCTGTCATCTGTGCTACTCAGATGCTGGAGAGCATGATCAAGAAGCCCCGCCCCACTCGGGCTGAAGGCAGTGATGTGGCCAATGCAGTCCTGGATGGAGCCGACTGCATCATGCTGTCTGGAGAAACAGCCAAAGGGGACTATCCTCTGGAGGCTGTGCGCATGCAGCACCTGATAGCTCGTGAGGCTGAGGCAGCCATGTTCCACCGCAAGCTGTTTGAAGAACTTGTGCGAGCCTCAAGTCACTCCACAGACCTCATGGAAGCCATGGCCATGGGCAGCGTGGAGGCTTCTTATAAGTGTTTAGCAGCAGCTTTGATAGTTCTGACGGAGTCTGGCAGGTAGGGCCCTAAGGGCAGGTAACACTGTTAGGATAACCAGCCTCTTGCTCCACCTGCTCTAGGAGAAGACAGCCAGGCCCAACCTGGCATCTGGGCACAGAGCCTCTTCTCGTCTGTAGGAACACCGCCAGGGAGGTCATGGCAGGGCAGGACCAAAGGGTCCTGTGGCTCAGTAGGCACAGTAGATGTCACAGGCACTTGGTGAAGGACTGGTTTCTGTGGAGTCTTGATCTTGGCTCAGCTCAGAATCTCCAGTGATTGGGCTCCTCTTGGCCTTTGTTCCCAGGAACATGTTCCTCACCAGCTGTCCGGTGACTCTTCCCCTCCCTCTCCTTTTGTGACAAAGCTCTGACAAAGCTCTGTCCCCCTCTCGTCCCTCTGGACGGATGTTGCTCCCCTAGATTGCCCGTGAGGCAGAGGCTGC