Transcript asmbl_46041

Sequence
Transcript Sequence for observation asmbl_46041 of TGE0059141:
GTGGCAGCAGCCGGGCTGAGAGGAGCGTGGCTGTCTCCTCTCTCCGCCATGGCGTGTGCTCGCCCACTGATATCGGTGTACTCCGAAAAGGGGGAGTCATCTGGCAAAAATGTCACTTTGCCTGCTGTATTCAAGGCTCCTATTCGACCAGATATTGTGAACTTTGTTCACACCAACTTGCGCAAAAACAACAGACAGCCCTATGCTGTCAGTGAATTAGCAGGTCATCAGACTAGTGCTGAGTCTTGGGGTACTGGCAGAGCTGTGGCTCGAATTCCCAGAGTTCGAGGTGGTGGGACTCACCGCTCTGGCCAGGGTGCTTTTGGAAACATGTGTCGTGGAGGCCGAATGTTTGCACCAACCAAAACCTGGCGCCGTTGGCATCGTAGAGTGAACACAACCCAAAAACGATACGCCATCTGTTCTGCCCTGGCTGCCTCAGCCCTACCAGCACTGGTCATGTCTAAAGGTCATCGTATTGAGGAAGTTCCTGAACTTCCTTTGGTAGTTGAAGATAAAGTTGAAGGCTACAAGAAGACCAAGGAAGCTGTTTTGCTCCTTAAGAAACTTAAAGCCTGGAATGATATCAAAAAGGTCTATGCCTCTCAGCGAATGAGAGCTGGCAAAGGCAAAATGAGAAACCGTCGCCGTATCCAGCGCAGGGGCCCGTGCATCATCTATAATGAGGATAATGGTATCATCAAGGCCTTCAGAAACATCCCTGGAATTACTCTGCTTAATGTAAGCAAGCTGAACATTTTGAAGCTTGCTCCTGGTGGGCATGTGGGACGTTTCTGCATTTGGACTGAAAGTGCTTTCCGGAAGTTAGATGAATTGTACGGCACTTGGCGTAAAGCCGCTTCCCTCAAGAGTAACTACAATCTTCCCATGCACAAGATGATTAATACAGATCTTAGCAGAATCTTGAAAAGCCCAGAGATCCAAAGAGCCCTTCGAGCACCACGCAAGAAGATCCATCGCAGAGTCCTAAAGAAGAACCCACTGAAAAACTTGAGAATCATGTTGAAGCTAAACCCATATGCAAAGACCATGCGCCGGAACACCATTCTTCGCCAGGCCAGGAATCACAAGCTCCGGGTGGATAAGGCAGCTGCTGCAGCAGCGGCACTACAAGCCAAATCAGATGAGAAGGCGGCGGTTGCAGGCAAGAAGCCTGTGGTAGGTAAGAAAGGAAAGAAGGCTGCTGTTGGTGTTAAGAAGCAGAAGAAGCCTCTGGTGGGAAAAAAGGCAGCAGCTACCAAGAAACCAGCCCCTGAAAAGAAGCCTGCAGAGAAGAAACCTACTACAGAGGAGAAGAAGCCTGCTGCATAAACTCTTAAATTTGATTATTCCATAAAGGTCAAATCATTTTGGACAGCTTCTTTTGAATAAAGACCTGATTATACAGGCAGTGAGAAACATGACTTGGTGTGCTCTGTAAAGCTTGGTTAGAATTTTTTTAAAGTGACATTTTGTTGGCCATAATTTAGACTGTTACATTTTATATAGTGTGGTATAAAATGGGGCATGGATTTATACTAAGTCCATGGAGTTCAGTGGAAGGGGAATGATTTAAAAAAAGTTGTGGTTTTCTAAATAATGTGGCTTGAAAAATAGGTGTAACAGGACTTGGTCAGAAACGCAGAGGCTGTTCAAGTTTAGCTCCCCACCAGATGGAAAATAGGTTAAATTCTGTAAAGATTTAACTTTAACCACAAGAGGGCACAACTGGAGAGCACAATTTTTTTGGTACTGCAGTAAAATTGATTACCTCTTGAGAAGTGTTCTTTTTAACCAGCTATAACAATAGAGTTGAGTATTTTCACCCATGGTTTGAAAAAGTGCCAGAAGGCCACACTGGCCCACATCTGTAATCCCAACACTTTG