Transcript asmbl_45687

Sequence
Transcript Sequence for observation asmbl_45687 of TGE0056226:
AGCCGAGCCGACCCGCCCCGCCGACGAACCCCCTGAAGCTGTGCCAAGATGTGTGACGACGAGGAGACCACCGCCCTGGTGTGCGACAACGGCTCTGGGCTGGTGAAGGCCGGCTTTGCGGGCGATGACGCGCCCCGCGCTGTCTTCCCGTCCATCGTGGGCCGCCCGCGGCACCAGGGAGTTATGGTGGGTATGGGTCAGAAGGACTCCTACGTAGGTGATGAAGCCCAGAGCAAGAGAGGCATCCTGACCCTGAAGTATCCCATCGAGCATGGTATCATCACCAACTGGGACGACATG