Transcript asmbl_45085

Sequence
Transcript Sequence for observation asmbl_45085 of TGE0056213:
GGGCGAGGCCTGGCAGCTGTAGTGCTTCTGGGCAGTAGAGGCGCGGGGTGCGGAGCTAGGGCGGCCGAGAGCCATGGCGGCGCTATTGGCGGCGGCGGCAGTGCGAGCCCGGATCCTGCAGGTTTCTTCCAAGGTGAAATCCAGTCCCACCTGGTATTCAGCATCTTCCTTCTCTTCTTCAGTGCCAACTGTAAAGCTCTTCATTGGTGGGAAATTCGTTGAATCCAAAAGTGACAAATGGATCGATATCCACAACCCAGCCACCAATGAGGTCATTGGTCGGGTCCCTCAGGCCACCAAGGCAGAAATGGATGCAGCCATTGCTTCCTGCAAACGTGCTTTTCCTGCATGGGCAGACACTTCAGTATTAAGCCGCCAGCAGGTCTTGCTCCGCTATCAACAACTTATTAAAGAAAACTTGAAAGAAATTGCCAAGTTAATCACATTGGAACAAGGGAAGACCCTAGCTGATGCTGAAGGAGATGTATTTCGAGGCCTTCAGGTGGTTGAGCATGCCTGTAGTGTGACATCCCTCATGATGGGAGAGACCATGCCATCCATCACCAAAGACATGGACCTTTATTCCTACCGTCTGCCTCTGGGAGTGTGTGCAGGCATTGCTCCATTCAATTTTCCTGCCATGATCCCCCTTTGGATGTTTCCCATGGCCATGGTGTGTGGAAATACCTTCCTAATGAAACCATCTGAGCGAGTCCCTGGAGCAACTATGCTTCTTGCTAAGTTGCTCCAGGATTCTGGTGCCCCTGATGGAACATTAAACATCATCCATGGACAGCATGAAGCTGTAAATTTTATTTGCGATCATCCGGACATCAAAGCAATCAGCTTTGTGGGATCCAACAAGGCAGGAGAGTATATCTTCGAGAGAGGATCAAGACATGGCAAGAGGGTTCAAGCCAATATGGGAGCCAAGAACCATGGGGTAGTCATGCCAGATGCCAATAAGGAAAATACCCTGAACCAGCTGGTTGGGGCAGCATTTGGAGCTGCTGGTCAGCGCTGCATGGCTCTTTCAACAGCAGTCCTTGTGGGAGAAGCCAAGAAGTGGCTGCCAGAGCTGGTGGAGCATGCCAAAAACCTGAGAGTCAATGCAGGAGATCAGCCTGGAGCTGATCTTGGCCCTCTGATCACTCCCCAGGCCAAAGAGCGAGTCTGTAATCTGATTGATAGTGGAACAAAGGAGGGAGCTTCCATCCTTCTTGATGGACGAAAAATTAAAGTGAAAGGCTATGAAAATGGCAACTTTGTTGGACCAACCATCATCTCGAATGTCAAGCCAAATATGACCTGTTACAAAGAGGAGATTTTTGGTCCAGTTCTTGTGGTTCTGGAGACAGAAACATTGGATGAAGCCATCCAGATTGTAAATAACAACCCATATGGAAATGGAACTGCCATCTTCACCACCAATGGAGCCACTGCTCGGAAATATGCCCACTTGGTGGATGTTGGACAGGTGGGAGTGAATGTCCCCATTCCAGTGCCTTTGCCAATGTTCTCATTCACCGGCTCTCGATCCTCCTTCAGGGGAGACACCAATTTCTATGGCAAACAGGGCATCCAATTCTACACTCAGTTAAAGACCATTACTTCTCAGTGGAAAGAAGAAGATGCTACTCTTTCCTCACCTGCTGTTGTCATGCCTACCATGGGCCGTTAGAAACAAGTTTGTTTAAGACTGACTCCATCCTGAGTAATCTCCCTTTATTTTTGACCAGCTTCATTTGTCAGCTTTGCTCAGATCAGATCGATGGGATTGGAATACATTGTAACTAAAATCTTCCTCAGGACTATTAACCCCCGCAAAGTTTCTATAGGGAACTGCCTAGTGTAACAATGAAACCAGATTTCTCACTTGCTCTTCATACTTCTATTTTGAGGTAACTGTTGTAACTATGAAATGCTTATCTGAAAGTAGTGCTTAAACCTGATTTCTAAAAATTATCCCATTTTCTGATGATTTGAAGGGGAGAAAAGCCAGTGTATGTAAAGAAAATGTTCCAGCCAGGCGCGGTGGCTCACGCCTGTAATTCCATCATTTTGGGAGGCCACAGTGGGCAGATTGCTTGAGCCCAGGAGTTGAAGAACGTGGCGAAACCCCGTATCTATTATTTAAAAAAATTGAAAAAGTAAAAAAAGAAAAGGGAAAAAAAATTTTTTAAAGAAGATGTTCCAATAATTGCAAGAAGAACTCTTAGATGGGGAAACAGGACAGAAATAACTCACCGCTTTTGGTTGATCCTCAAACATAGCGCTACCTAAATGCCACTGGGAGAGACCTCCTGCAAAGTTTTCTTTAGCCCCTCTTTTATCCCACAATACACAAGATATAATCCATTTTTATATATCCCAAAGTTGTGGCAACAGCTTCTTTCTTTTCTGCTCAATGCCACTTTGTTTCCTAGTAATTCATGACCACTATTAATTCTATCATTGTCACTGCTCCTGCTTAAGATCACTTCTCAAGGATACCTCAGTAAGCAATGGATAAATCAACTTTTTGTTATATGTGCCAAGTACTAAGTTTCAGGGTTCTCTTCAGCAATCATTAATTAATACTTCAGCCATTAATTCAGATGCAAATAATTTTCTTTTTTCTTTTTTTTGAGATGGAG