Transcript asmbl_45046

Sequence
Transcript Sequence for observation asmbl_45046 of TGE0056789:
GTTTGGGCAACTCGGCCTGGCCAATGGAGAGCCTCGGGAGGGCTCTGCCCCTTCCCCCCGCCCCCGCCCGCCTCGGCTCCCGCAGCGCTAGTGTGTCCGCCTAGTTCAGTGTGCGTGGAGATTAGGTCCAAGCGCCCGCCCAGAGGCAGGCAGTCCGCGAGCCCAGCCGCCGCTGTCGCCGCCAGTAGCAGCCTTCGCCAGCAGCGCCGCGGCGGAACCGGGCGCAGGGGAGCGAGCCCGGCCCCGCCAGCCCAGCCCAGCCCAGCCCTACTCCCTCCCCACGCCAGGGCAGCAGCCGTTGCTCAGAGAGAAGGTGGAGGAAGAAATCCAGACCCTAGCACGCGCGCACCATCATGGACCATTATGATTCTCAGCAAACCAACGATTACATGCAGCCAGAAGAGGACTGGGACCGGGACCTGCTCCTGGACCCGGCCTGGGAGAAGCAGCAGAGAAAGACATTCACGGCATGGTGTAACTCCCACCTCCGGAAGGCGGGGACACAGATCGAGAACATCGAAGAGGACTTCCGGGATGGCCTGAAGCTCATGCTGCTGCTGGAGGTCATCTCAGGTGAACGCTTGGCCAAGCCAGAGCGAGGCAAGATGAGAGTGCACAAGATCTCCAACGTCAACAAGGCCCTGGATTTCATAGCCAGCAAAGGCGTCAAACTGGTGTCCATCGGAGCCGAAGAAATCGTGGATGGGAATGTGAAGATGACCCTGGGCATGATCTGGACCATCATCCTGCGCTTTGCCATCCAGGACATCTCCGTGGAAGAGACTTCAGCCAAGGAAGGGCTGCTCCTGTGGTGTCAGAGAAAGACAGCCCCTTACAAAAATGTCAACATCCAGAACTTCCACATAAGCTGGAAGGATGGCCTCGGCTTCTGTGCTTTGATCCACCGACACCGGCCCGAGCTGATTGACTACGGGAAGCTGCGGAAGGATGATCCACTCACAAATCTGAATACGGCTTTTGACGTGGCAGAGAAGTACCTGGACATCCCCAAGATGCTGGATGCCGAAGACATCGTTGGAACTGCCCGACCGGATGAGAAAGCCATCATGACTTACGTGTCTAGCTTCTACCACGCCTTCTCTGGAGCCCAGAAGGCGGAGACAGCAGCCAATCGCATCTGCAAGGTGTTGGCCGTCAACCAGGAGAACGAGCAGCTTATGGAAGACTACGAGAAGCTGGCCAGTGATCTGTTGGAGTGGATCCGCCGCACAATCCCGTGGCTGGAGAACCGGGTGCCCGAGAACACCATGCATGCCATGCAACAGAAGCTGGAGGACTTCCGGGACTACCGGCGCCTGCACAAGCCGCCCAAGGTGCAGGAGAAGTGCCAGCTGGAGATCAACTTCAACACGCTGCAGACCAAGCTGCGGCTCAGCAACCGGCCTGCCTTCATGCCCTCTGAGGGCAGGATGGTCTCGGACATCAACAATGCCTGGGGCTGCCTGGAGCAGGTGGAGAAGGGCTATGAGGAGTGGTTGCTGAATGAGATCCGGAGGCTGGAGCGACTGGACCACCTGGCAGAGAAGTTCCGGCAGAAGGCCTCCATCCACGAGGCCTGGACTGACGGCAAAGAGGCCATGCTGCGACAGAAGGACTATGAGACCGCCACCCTCTCGGAGATCAAGGCCCTGCTCAAGAAGCATGAGGCCTTCGAGAGTGACCTGGCTGCCCACCAGGACCGTGTGGAGCAGATTGCCGCCATCGCACAGGAGCTCAATGAGCTGGACTATTATGACTCACCCAGTGTCAACGCCCGTTGCCAAAAGATCTGTGACCAGTGGGACAATCTGGGGGCCCTAACTCAGAAGCGAAGGGAAGCTCTGGAGCGGACCGAGAAACTGCTGGAGACCATTGACCAGCTGTACTTGGAGTATGCCAAGCGGGCTGCACCCTTCAACAACTGGATGGAGGGGGCCATGGAGGACCTGCAGGACACCTTCATTGTGCACACCATTGAGGAGATCCAGGGACTGACCACAGCCCATGAGCAGTTCAAGGCCACCCTCCCTGATGCCGACAAGGAGCGCCTGGCCATCCTGGGCATCCACAATGAGGTGTCCAAGATTGTCCAGACCTACCACGTCAATATGGCGGGCACCAACCCCTACACAACCATCACGCCTCAGGAGATCAATGGCAAATGGGACCACGTGCGGCAGCTGGTGCCTCGGAGGGACCAAGCTCTGACGGAGGAGCATGCCCGACAGCAGCACAATGAGAGGCTACGCAAGCAGTTTGGAGCCCAGGCCAATGTCATCGGGCCCTGGATCCAGACCAAGATGGAGGAGATCGGGAGGATCTCCATTGAGATGCATGGGACCCTGGAGGACCAGCTCAGCCACCTGCGGCAGTATGAGAAGAGCATCGTCAACTACAAGCCAAAGATTGATCAGCTGGAGGGCGACCACCAGCTCATCCAGGAGGCGCTCATCTTCGACAACAAGCACACCAACTACACCATGGAGCACATCCGTGTGGGCTGGGAGCAGCTGCTCACCACCATCGCCAGGACCATCAATGAGGTAGAGAACCAGATCCTGACCCGGGATGCCAAGGGCATCAGCCAGGAGCAGATGAATGAGTTCCGGGCCTCCTTCAACCACTTTGACCGGAAGAAGACAGGCATGATGGACACGGATGATTTCCGCGCCTGCCTGATCTCCATGGGTTACAACATGGGAGAAGCAGAATTTGCCCGCATCATGAGCATTGTGGACCCCAACCGCCTGGGGGTAGTGACATTCCAGGCCTTCATTGACTTCATGTCCCGCGAGACAGCCGACACAGATACAGCAGACCAAGTCATGGCTTCCTTCAAGATCCTGGCTGGGGACAAGAACTACATTACCATGGACGAGCTGCGCCGCGAGCTGCCACCCGACCAGGCTGAGTACTGCATCGCGCGGATGGCCCCCTACACCGGCCCCGACTCCGTGCCAGGTGCTCTGGACTACATGTCCTTCTCCACGGCGCTGTACGGCGAGAGTGACCTCTAATCCACCCCGCCCGGCCGCCCTCGTCTTGTGCGCCGTGCCCTGCCTTGCACCTCCGCCGTCGCCCATCTCCTGCCTGGGTTCGGTTTCAGCTCCCAGCCTCCACCCGGGTGAGCTGGGGCCCACGTGGCATCGATCCTCCCTGCCCGCGAAGTGACAGTTTACAAAATTATTTTCTGCAAAAAAGAAAAAAAAGTTACGTTAAAAACCAAAAAACTACATATTTTATTATAGAAAAAGTATTTTTTCTCCACCAGACAAATGGAAAAAAAGAGGAAAGATTAACTATTTGCACCGAAATGTCTTGTTTTGTTGCGACATAGGAAAATAACCAAGCACAAAGTTATATTCCATCCTTTTTACTGATTTTTTTTTCTTCTATCTGTTCCATCTGCTGTATTCATTTCTCCAATCTCATGTCCATTTTGGTGTGGGAGTCGGGGTAGGGGGTACTCTTGTCAAAAGGCACATTGGTGCATGTGTGTTTGCTAGCTCACTTGTCCATGAAAATATTTTATGATATTAAAGAAAATCTTTTGAAATGGCTGTTTTTTAAGGAAGAGAATTTATGTGGCTTCTCATTTTTAAATCCCCTCAGAGGTGTGACTAGTCTCTTTATCAGCACACACTTAAAAAATTTTTAATATTGTCTATTAAAAATAGGACAAACTTGGAGAGTATGGACAACTTTGATATTGCTTGGCACAGATGGTATTAAAAAAACCACACTCCTATGACAGC