Transcript asmbl_44946

Sequence
Transcript Sequence for observation asmbl_44946 of TGE0000444:
CCCGCTCAGGGCAGCTCTGCGGGCGGCGAAGGAGGGAGCCAGCGCGCCCAGCCCAGCCAGGCTCGGACAGAGGGGGCGGGGAGAGGGTGGAGCGCGGGGAGCCAGGCGAGGGGCCGCGACGACGGGACTCCATTAGCCGCTCCGGCCACAGGCAGCGCTTCGCCAGCCGAGGAACCGGACGCGGACACCGCCGCCCCGCGAGCCTCCAGCCCCTCGCCTGTTGCCGCGCGAGTCCCGGGCCCGGAGCGCTAGGAGCGCGCGGAAGGAGCCATGGCTCTGGACGGGATAAGGATGCCAGATGGCTGCTACGCGGACGGGACGTGGGAACTGAGTGTCCATGTGACGGACCTGAACCGCGATGTCACCCTGAGAGTGACCGGCGAGGTGCACATTGGAGGCGTGATGCTTAAGCTGGTGGAGAAACTCGATGTAAAAAAAGATTGGTCTGACCATGCTCTCTGGTGGGAAAAGAAGAGAACTTGGCTTCTGAAGACACATTGGACCTTAGATAAGTATGGTATTCAGGCAGATGCTAAGCTTCAGTTCACCCCTCAGCACAAACTGCTCCGCCTGCAGCTTCCCAACATGAAGTATGTGAAGGTGAAAGTGAATTTCTCTGATAGAGTCTTCAAAGCTGTTTCTGACATCTGTAAGACTTTTAATATCAGACACCCCGAAGAACTTTCTCTCTTAAAGAAACCCAGAGATCCAACAAAGAAAAAAAAGAAGAAGCTAGATGACCAGTCTGAAGATGAGGCACTTGAATTAGAGGGGCCTCTTATCACTCCTGGATCAGGAAGTATATATTCAAGCCCAGGACTGTATAGTAAAACAATGACCCCCACTTATGATGCTCATGATGGAAGCCCCTTGTCACCAACTTCTGCTTGGTTTGGTGACAGTGCTTTGTCAGAAGGCAATCCTGGTATACTTGCTGTCAGTCAACCAATCACGTCACCAGAAATCTTGGCAAAAATGTTCAAGCCTCAAGCTCTTCTTGATAAAGCAAAAATCAACCAAGGATGGCTTGATTCCTCAAGATCTCTCATGGAACAAGATGTGAAGGAAAATGAGGCCTTGCTGCTCCGATTCAAGTATTACAGCTTTTTTGATTTGAATCCAAAGTATGATGCAATCAGAATCAATCAGCTTTACGAGCAGGCCAAATGGGCCATTCTCCTGGAAGAGATTGAATGCACAGAAGAAGAAATGATGATGTTTGCAGCCCTGCAGTATCATATCAATAAGCTGTCAATCATGACATCAGAGAATCATTTGAACAACAGTGACAAAGAAGTTGATGAAGTTGATGCTGCCCTTTCAGACCTGGAGATTACTCTGGAAGGGGGTAAAACGTCAACAATTTTGGGTGACATTACTTCCATTCCTGAACTTGCTGACTACATTAAAGTTTTCAAGCCAAAAAAGCTGACTCTGAAAGGTTACAAACAATATTGGTGCACCTTCAAAGACACATCCATTTCTTGTTATAAGAGCAAAGAAGAATCCAGTGGCACACCAGCTCATCAGATGAACCTCAGGGGATGTGAAGTTACCCCAGATGTAAACATTTCAGGCCAAAAATTTAACATTAAACTCCTGATTCCAGTTGCAGAAGGCATGAATGAAATCTGGCTTCGTTGTGACAATGAAAAACAGTATGCACACTGGATGGCAGCCTGCAGATTAGCCTCCAAAGGCAAGACCATGGCGGACAGTTCTTACAACTTAGAAGTTCAGAATATTCTTTCCTTTCTGAAGATGCAGCATTTAAACCCAGATCCTCAGTTAATACCAGAGCAGATCACGACTGATATAACTCCTGAATGTTTGGTGTCTCCCCGCTATCTAAAAAAGTATAAGAACAAGCAGATAACAGCGAGAATCTTGGAGGCCCATCAGAATGTAGCTCAGATGAGTCTAATTGAAGCCAAGATGAGATTTATTCAAGCTTGGCAGTCACTACCTGAATTTGGCATCACTCACTTCATTGCAAGGTTCCAAGGGGGCAAAAAAGAAGAACTTATTGGAATTGCATACAACAGACTGATTCGGATGGATGCCAGCACTGGAGATGCAATTAAAACATGGCGTTTCAGCAACATGAAACAGTGGAATGTCAACTGGGAAATCAAAATGGTCACCGTAGAGTTTGCAGATGAAGTACGATTGTCCTTCATTTGTACTGAAGTAGATTGCAAAGTGGTTCATGAATTCATTGGTGGCTACATATTTCTCTCAACACGTGCAAAAGACCAAAACGAGAGTTTAGATGAAGAGATGTTCTACAAACTTACCAGTGGTTGGGTGTGAATAGGAATACTGTTTAATGAAACTCCACGGCCATAACAATATTTAACTTTAAAAGCTGTTTGTTATATGCTGCTTAATAAAGTAAGCTTGAAATTTATCATTTTATCATGAAAACTTCTTTGCCTTACCAGACCAGTTAATATGTGCACTAAACAAGCACGACTATTAATCTATCATGTTATGATATAATAAACTTGAATTTGTCACACATTCCTTAGGGCCATGAATTGAAAACTGAAATAGTGGGCAAATCAGGAACAAACCATCACTGATTTACTGATTTAAGCTAGCCAAACTGTAAGAAACAAGCCATCTATTTTAAAGCTATCCAGGGCTTAACCTATATGAACTCTATTTATCATGTCTAATGCATGTGATTTAATGTATGTTTAATTTGATATCATGTTTTAAAATATCCTACTTCTGGTAGCCATTTAATTCCTCCCCCTACCCCCAAATAAATCAGGCATGCAGGAGGCCTGATATTTAGTAATGTCATTGTGTTTGACCTTGAAGGAAAATGCTATTAGTCCGTCGTGCTTGATTTGTTTTTGTCCTTGAATAAGCATGTTATGTATATTGTCTCGTGTTTTTATTTTTACACCATATTGTATTACACTTTTAGTATTCACCAGCATAATCACTGTCTGCCTAAAATATGCAACTCTTTGCATTACAATATGAAGTAAAGTTCTATGAAGTATGCATTTTGTGTAACTAATGTAAAAACACAAATTTTATAAAATTGTACAGTTTTTTAAAAACTACTCACAACTAGCAGATGGCTTAAATGTAGCAATCTCTGCGTTAATTAAATGCCTTTAAGAGATATAATTAACGTGCAGTTTTAATATCTACTAAATTAAGAATGACTTCATTATGATCATGATTTGCCACAATGTCCTTAACTCTAATGCCTGGACTGGCCATGTTCTAGTCTGTTGCGCTGTTACAATCTGTATTGGTGCTAGTCAGAAAATTCCTAGCTCACATAGCCCAAAAGGGTGCGAGGGAGAGGTGGATTACCAGTATTGTTCAATAATCCATGGTTCAAAGACTGTATAAATGCATTTTATTTTAAATAAAAGCAAAACTTTTATTTAA