Transcript asmbl_44647

Sequence
Transcript Sequence for observation asmbl_44647 of TGE0000421:
GGGGGCCATTTTGTGAAGAGACGAAGACTGAGCGGTTGTGGCCGCGTTGCCGACCTCCAGCAGCAGTCGGCTTCTCTACGCAGAACCCGGGAGTAGGAGACTCAGAATCGAATCTCTTCTCCCTCCCCTTCTTGTGAGATTTTTTTGATCTTCAGCTACAGTAAGTTATTCCAATTTTTTTTTAACATTTTTCCTGACTTTCCGCTGATTTCCTTTTTATTGTTGTTACTAGTTACTATTACTTATTATTATTATATTAATACTTATGATGGTGATGATGATGATGATAATGACACTGATGATTTTTAACCGGATTAAAATCGAGTTTTTCTGAATGTTTCTAAGAATTTCTCCGGCCTCCTGATTGACTTTGGAGTTTTGCATCTTGGGAGAGAAAGCGAAGGCATTAGTATTTTTAAGTGGTTTGATCACGTAAACCTTTTCTCTCCCAACCCCACCCTTGCCCTCATCCCCTTCCCCACACTGAAAAGAATTTTACTGGCTGTTAAGTCTATGACCTTATTTTTCCTGATCTTTAACTTAACTGTTTTAGAGCATCTCTGGACGTCTGTATTTTTAATTTTTTTTATTTTTGTTTTTTTATTTTTAATCTTTCATTTGTTAAATTTTTAAACTGTGCTGCAATAAAATGTGTGTGGTACTACTTAACACTTATGATCGTGATGGCATTTTCCCTGAAAGCCATCTTCCTCCTGTTTCCCTTGAAATCCCATCCTGCTTTTCCTGTACACTACCCCTCACAAACCACAAGCTGCAGCAACATGGATGCCCAGCCTGGAGCAGCAGCAGCCAGGATGACCTGGAGCCAGGGGGGCCTTCGGAACAGATGCACACCCTTCCTGGGTGATGTTTTCGGCTTTGTGAGAAACCTTACCATCAAACACGATGGCCAGCAACGTTACCAACAAGACAGATCCTCGCTCCATGAACTCCCGTGTATTCATTGGGAATCTCAACACTCTTGTGGTCAAGAAATCTGATGTGGAGGCAATCTTTTCGAAGTATGGCAAAATTGTGGGCTGCTCTGTTCATAAGGGCTTTGCCTTCGTTCAGTATGTTAATGAGAGAAATGCCCGGGCTGCTGTAGCAGGAGAGGATGGCAGAATGATTGCTGGCCAGGTTTTAGATATTAACCTGGCTGCAGAGCCAAAAGTGAACCGAGGAAAAGCAGGTGTGAAACGATCTGCAGCGGAGATGTACGGCTCCTCTTTTGACTTGGACTATGACTTTCAACGGGACTATTATGATAGGATGTACAGTTACCCAGCACGTGTACCTCCTCCTCCTCCTATTGCTCGGGCTGTAGTGCCCTCGAAACGTCAGCGTGTATCAGGAAACACTTCACGAAGGGGCAAAAGTGGCTTCAATTCTAAGAGTGGACAGCGGGGATCTTCCAAGTCTGGAAAGTTGAAAGGAGATGACCTTCAGGCCATTAAGAAGGAGCTGACCCAGATAAAACAAAAAGTGGATTCTCTCCTGGAAAACCTGGAAAAAATTGAAAAGGAACAGAGCAAACAAGCAGTAGAGATGAAGAATGATAAGTCAGAAGAGGAGCAGAGCAGCAGCTCCGTGAAGAAAGATGAGACTAATGTGAAGATGGAGTCTGAGGGGGGTGCAGATGACTCTGCTGAGGAGGGGGACCTACTGGATGATGATGATAATGAAGATCGGGGGGATGACCAGCTGGAGTTGATCAAGGATGATGAAAAAGAGGCTGAGGAAGGAGAGGATGACAGAGACAGCGCCAATGGCGAGGATGACTCTTAAGCACATAGTGGGGTTTAGAAATCTTATCCCATTATTTCTTTACCTAGGCGCTTGTCTAAGATCAAATTTTTCACCAGATCCTCTCCCCTAGTATCTTCAGCACATGCTCACTGTTCTCCCCATCCTTGTCCTTCCCATGTTCATTAATTCATATTGCCCCGCGCCTAGTCCCATTTTCACTTCCTTTGACGCTCCTAGTAGTTTTGTTAAGTCTTACCCTGTAATTTTTGCTTTTAATTTTGATACCTCTTTATGACTTAACAATAAAAAGGATGTATGGTTTTTATCAACTGTCTCCAAAATAATCTCTTGTTATGCAGGGAGTACAGTTCTTTTCATTCATACATAAGTTCAGTAGTTGCTTCCCTAACTGCAAAGGCAATCTCATTTAGTTGAGTAGCTCTTGAAAGCAGCTTTGAGTTAGAAGTATGTGTGTTACACCCTCACATTAGTGTGCTGTGTGGGGCAGTTCAACACAAATGTAACAATGTATTTTTGTGAATGAGAGTTGGCATGTCAAATGCATCCTCTAGAAAAATAATTAGTGTTATAGTCTTAAGATTTGTTTTCTAAAGTTGATACTGTGGGTTATTTTTGTGAACAGCCTGATGTTTGGGACCTTTTTTCCTCAAAATAAACAAGTCCTTATTAAACCAGGAATTTGGAGAAAAAAAAAACCCTGGTTTTTTATTTTTGTATTTTATTATTGTTTACTTCAAACTTTGTTTTACAGCGTCCTCCACAAAACCTCTAGAATGCACTAGATATATTTTTCTTGGAGTCATAATCATGATGCATACCAACACAACACTACTCAAATTATATTTCATTGAGATGCATGTTGCATTGAGGAGTCAACTTGACATAGAGTGGAGACTTTTTCAAAATGGCTTTTACATCCTAATGAAAGTTTGGGAAGTATATCCTCTCTGCCTTTTCATCAGTGCTTTGTGGTCCAGCTGGCACCCTTTCTGAGGTTTGTGTTTTGTGCTAAATGGTTTTGTCCTTAAATAGGAGAGGCTCAAAAACATCAAGATTTCAGGAAAATGGCGACAGCTGCATAATGGAACCCCCCTGCTTCTATTTTGTTCTTTTAATTACTATTTATAGCCCCAGTTACCTTCTGAATTCTGAAGTGTATATACCTCCATGTTCCTGAAAACAAGAAAACTCTTACTTCCTGATATTCCATAGACTGCCTTCCCAGGTGATTGAGAACATAGAGAATGTTACACATTTATTTTACTCTAAATGATCTTTTACCCCTGTTAGCTAATCTTTGTGTTTTCCTCAACTTTATTAATTACAGTGATTGCATTTTTAGCATCCAGTTGTAAGATGAATATATTAAACAGCTACCAGTGTTGGTGATACCTCATCCTTGAAAGGCTTAGTTCATTTGTGTTTTATACTTCAGTTTTTCCAGCATAGCAGAAAATGCCGCTTATAATTTTTGTGCACACAAACCTTGGATTCCCCTGTAAAGTTGCTATTGTTTCATAGCATGCGGCACTGGCCTTTTTTCATCCTACTCATTACAGGCAAAACTCATGTCTTATTTATGAGGATTTTATAGATCATTTTCTGTAACAGGTGACAAAAGCAGAAAAGAATGAAGAGGCTGAAGTATGAACTACCCTTGGAGCCCATATACATGATATAGGCAATTTCTTTTGTATGTTAATTCAGTCAAAAATACTACCCACTTGATGTTTTCTAATCTGATGTGAGCTCATGTTACACAGACTTTTAGTAAGTAACCCGTGACTAGAAAATAAACTGGATGCTTAGGAGAGAGTGTCAGATGTATAAGATGCTAATAAAACCTGTTTAATATTATTGTTAGCTGTAAGTTTTTGGGAAATACTGAACAAATTAGTCCACAATCAAGTGTCTACTTTTCCCTTCACTGTAGGGCCTCTCCCTGCACAGAGCAGTCTGTTTAGCTGTGAACACCACAATCTGCAGATGTTCAAGTCCCTTACATAAAATGGCATAGTATTTATATGTAACCTATGCATATTCTCCTGTATATTTTAAATCATCTCTACATTAAAATACCTGATAAAATGTAAATGGTATGTAAATAGTTGTAACTTTTTTTATTTATATTTTTGTTAACTTTTTTTAGTTTTTTTTCTTTGCTAGTATTTTCGATCTGTAGTTGGCTGAATCTGCATGTGCAGAACCCATGAACATGGGGGGCCAACTATACATTTTATTCTAGGAAAGCAGGTATTGAATGAAGCTGTGGAGAGCGCTTTTTAATATTAGGTTGGTGCA