Transcript asmbl_44646

Sequence
Transcript Sequence for observation asmbl_44646 of TGE0000421:
GGGGGCCATTTTGTGAAGAGACGAAGACTGAGCGGTTGTGGCCGCGTTGCCGACCTCCAGCAGCAGTCGGCTTCTCTACGCAGAACCCGGGAGTAGGAGACTCAGAATCGAATCTCTTCTCCCTCCCCTTCTTGGGCAGCAAGGCGAACCCCATCCCTACTCACTGGAGCTCAGCTTTGATTTTTAACCTCCCTTCCCCACCCTTCCAGAACACACACATTCCATTCCAAAACTGATTTTATAAAGACATTTTAAACATAATGATGCAACTTGGTGTGCACTACAGCAAATGTACAGGTGTTTTTTTTTTAATTGTTTCCAAAACCGGGACCTGGATTTAAGATGTAATTTTTAAAATTTCTATTTCTATTTTTTCTGCAGCAGTTGGGTTAGAGGAGGAGGAGCCTTTTAGCCTCTCATAAACTGACCTCTCTACTTCCTCGTGTATTTTTAAGATTGATTGATGATGTGGAAAGGGCTTTGCTTGTCTGCTACTGAAAACTTTATCCTTGCGGTTTTTGTGGAAACTGCTTTTGGAAAGAGAAAAGAAATGAACTTTACTGACTTGACATTTTTGCACCTCCCGTTTTTCTAATCTGGGCTATTTTTATTTTTGTTTTTTTACAGTGAGATTTTTTTGATCTTCAGCTACAGTAAGTTATTCCAATTTTTTTTTAACATTTTTCCTGACTTTCCGCTGATTTCCTTTTTATTGTTGTTACTAGTTACTATTACTTATTATTATTATATTAATACTTATGATGGTGATGATGATGATGATAATGACACTGATGATTTTTAACCGGATTAAAATCGAGTTTTTCTGAATGTTTCTAAGAATTTCTCCGGCCTCCTGATTGACTTTGGAGTTTTGCATCTTGGGAGAGAAAGCGAAGGCATTAGTATTTTTAAGTGGTTTGATCACGTAAACCTTTTCTCTCCCAACCCCACCCTTGCCCTCATCCCCTTCCCCACACTGAAAAGAATTTTACTGGCTGTTAAGTCTATGACCTTATTTTTCCTGATCTTTAACTTAACTGTTTTAGAGCATCTCTGGACGTCTGTATTTTTAATTTTTTTTATTTTTGTTTTTTTATTTTTAATCTTTCATTTGTTAAATTTTTAAACTGTGCTGCAATAAAATGTGTGTGGTACTACTTAACACTTATGATCGTGATGGCATTTTCCCTGAAAGCCATCTTCCTCCTGTTTCCCTTGAAATCCCATCCTGCTTTTCCTGTACACTACCCCTCACAAACCACAAGCTGCAGCAACATGGATGCCCAGCCTGGAGCAGCAGCAGCCAGGATGACCTGGAGCCAGGGGGGCCTTCGGAACAGATGCACACCCTTCCTGGGTGATGTTTTCGGCTTTGTGAGAAACCTTACCATCAAACACGATGGCCAGCAACGTTACCAACAAGACAGATCCTCGCTCCATGAACTCCCGTGTATTCATTGGGAATCTCAACACTCTTGTGGTCAAGAAATCTGATGTGGAGGCAATCTTTTCGAAGTATGGCAAAATTGTGGGCTGCTCTGTTCATAAGGGCTTTGCCTTCGTTCAGTATGTTAATGAGAGAAATGCCCGGGCTGCTGTAGCAGGAGAGGATGGCAGAATGATTGCTGGCCAGGTTTTAGATATTAACCTGGCTGCAGAGCCAAAAGTGAACCGAGGAAAAGCAGGTGTGAAACGATCTGCAGCGGAGATGTACGGCTCCTCTTTTGACTTGGACTATGACTTTCAACGGGACTATTATGATAGGATGTACAGTTACCCAGCACGTGTACCTCCTCCTCCTCCTATTGCTCGGGCTGTAGTGCCCTCGAAACGTCAGCGTGTATCAGGAAACACTTCACGAAGGGGCAAAAGTGGCTTCAATTCTAAGAGTGGACAGCGGGGATCTTCCAAGTCTGGAAAGTTGAAAGGAGATGACCTTCAGGCCATTAAGAAGGAGCTGACCCAGATAAAACAAAAAGTGGATTCTCTCCTGGAAAACCTGGAAAAAATTGAAAAGGAACAGAGCAAACAAGCAGTAGAGATGAAGAATGATAAGTCAGAAGAGGAGCAGAGCAGCAGCTCCGTGAAGAAAGATGAGACTAATGTGAAGATGGAGTCTGAGGGGGGTGCAGATGACTCTGCTGAGGAGGGGGACCTACTGGATGATGATGATAATGAAGATCGGGGGGATGACCAGCTGGAGTTGATCAAGGATGATGAAAAAGAGGCTGAGGAAGGAGAGGATGACAGAGACAGCGCCAATGGCGAGGATGACTCTTAAGCACATAGTGGGGTTTAGAAATCTTATCCCATTATTTCTTTACCTAGGCGCTTGTCTAAGATCAAATTTTTCACCAGATCCTCTCCCCTAGTATCTTCAGCACATGCTCACTGTTCTCCCCATCCTTGTCCTTCCCATGTTCATTAATTCATATTGCCCCGCGCCTAGTCCCATTTTCACTTCCTTTGACGCTCCTAGTAGTTTTGTTAAGTCTTACCCTGTAATTTTTGCTTTTAATTTTGATACCTCTTTATGACTTAACAATAAAAAGGATGTATGGTTTTTATCAACTGTCTCCAAAATAATCTCTTGTTATGCAGGGAGTACAGTTCTTTTCATTCATACATAAGTTCAGTAGTTGCTTCCCTAACTGCAAAGGCAATCTCATTTAGTTGAGTAGCTCTTGAAAGCAGCTTTGAGTTAGAAGTATGTGTGTTACACCCTCACATTAGTGTGCTGTGTGGGGCAGTTCAACACAAATGTAACAATGTATTTTTGTGAATGAGAGTTGGCATGTCAAATGCATCCTCTAGAAAAATAATTAGTGTTATAGTCTTAAGATTTGTTTTCTAAAGTTGATACTGTGGGTTATTTTTGTGAACAGCCTGATGTTTGGGACCTTTTTTCCTCAAAATAAACAAGTCCTTATTAAACCAGGAATTTGGAGAAAAAAAAAACCCTGGTTTTTTATTTTTGTATTTTATTATTGTTTACTTCAAACTTTGTTTTACAGCGTCCTCCACAAAACCTCTAGAATGCACTAGATATATTTTTCTTGGAGTCATAATCATGATGCATACCAACACAACACTACTCAAATTATATTTCATTGAGATGCATGTTGCATTGAGGAGTCAACTTGACATAGAGTGGAGACTTTTTCAAAATGGCTTTTACATCCTAATGAAAGTTTGGGAAGTATATCCTCTCTGCCTTTTCATCAGTGCTTTGTGGTCCAGCTGGCACCCTTTCTGAGGTTTGTGTTTTGTGCTAAATGGTTTTGTCCTTAAATAGGAGAGGCTCAAAAACATCAAGATTTCAGGAAAATGGCGACAGCTGCATAATGGAACCCCCCTGCTTCTATTTTGTTCTTTTAATTACTATTTATAGCCCCAGTTACCTTCTGAATTCTGAAGTGTATATACCTCCATGTTCCTGAAAACAAGAAAACTCTTACTTCCTGATATTCCATAGACTGCCTTCCCAGGTGATTGAGAACATAGAGAATGTTACACATTTATTTTACTCTAAATGATCTTTTACCCCTGTTAGCTAATCTTTGTGTTTTCCTCAACTTTATTAATTACAGTGATTGCATTTTTAGCATCCAGTTGTAAGATGAATATATTAAACAGCTACCAGTGTTGGTGATACCTCATCCTTGAAAGGCTTAGTTCATTTGTGTTTTATACTTCAGTTTTTCCAGCATAGCAGAAAATGCCGCTTATAATTTTTGTGCACACAAACCTTGGATTCCCCTGTAAAGTTGCTATTGTTTCATAGCATGCGGCACTGGCCTTTTTTCATCCTACTCATTACAGGCAAAACTCATGTCTTATTTATGAGGATTTTATAGATCATTTTCTGTAACAGGTGACAAAAGCAGAAAAGAATGAAGAGGCTGAAGTATGAACTACCCTTGGAGCCCATATACATGATATAGGCAATTTCTTTTGTATGTTAATTCAGTCAAAAATACTACCCACTTGATGTTTTCTAATCTGATGTGAGCTCATGTTACACAGACTTTTAGTAAGTAACCCGTGACTAGAAAATAAACTGGATGCTTAGGAGAGAGTGTCAGATGTATAAGATGCTAATAAAACCTGTTTAATATTATTGTTAGCTGTAAGTTTTTGGGAAATACTGAACAAATTAGTCCACAATCAAGTGTCTACTTTTCCCTTCACTGTAGGGCCTCTCCCTGCACAGAGCAGTCTGTTTAGCTGTGAACACCACAATCTGCAGATGTTCAAGTCCCTTACATAAAATGGCATAGTATTTATATGTAACCTATGCATATTCTCCTGTATATTTTAAATCATCTCTACATTAAAATACCTGATAAAATGTAAATGGTATGTAAATAGTTGTAACTTTTTTTATTTATATTTTTGTTAACTTTTTTTAGTTTTTTTTCTTTGCTAGTATTTTCGATCTGTAGTTGGCTGAATCTGCATGTGCAGAACCCATGAACATGGGGGGCCAACTATACATTTTATTCTAGGAAAGCAGGTATTGAATGAAGCTGTGGAGAGCGCTTTTTAATATTAGGTTGGTGCA