Transcript asmbl_44409

Sequence
Transcript Sequence for observation asmbl_44409 of TGE0059626:
ACATAGGATTCTGCCTCTGTAACCGGTCTACTGGTGAACCCCAGCTCTGTGATGAAATACTCCCCTCTCTCTGAACAGTCCCGCCAAGAGTTGGAGCAGCACTCAGTAGACACGGCCAGCACCTCCGATGCAGTGACCTTCATCACCTATGTGCAGTCTTTGAAACGGAAGATCAAGCAGTTTGAGAAGCAAGTTGAGCTCTACCGCAATGGCCAGCGCTTACTGGAAAAGCAAAGGTTCCAGTTCCCACCTTCCTGGCTTTATATTGACAACATCGAGGGAGAGTGGGGAGCCTTCAATGACATCATGCGGCGAAAGGACTCTGCCATTCAGCAGCAGGTGGCAAACCTGCAAATGAAGATTGTCCAGGAGGATCGGGCCGTGGAAAGCCGCACCACCGACCTGCTGACTGACTGGGAGAAGACCAAGCCTGTCACGGGCAACCTTCGCCCAGAAGAGGCACTTCAGGCTCTCACCATATATGAGGGGAAGTTTGGTAGGCTGAAGGACGACAGAGAGAAGTGTGCAAAGGCCAAGGAGGCGCTGGAATTGACAGATACTGGGCTTCTCAGTGGCAGTGAAGAGCGCGTGCAGGTGGCCTTAGAAGAATTACAGGACCTCAAAGGCGTTTGGTCAGAACTTTCTAAGGTTTGGGAGCAAATCGATCAGATGAAGGAGCAACCCTGGGTTTCAGTACAGCCTCGAAAGCTTCGACAAAATTTGGATGCCCTCCTGAACCAGCTGAAAAGCTTCCCTGCCCGGTTGCGACAGTATGCGTCCTATGAGTTTGTTCAGAGGCTTCTGAAAGGTTACATGAAGATAAATATGCTGGTGATTGAACTGAAATCCGAAGCACTTAAAGACCGCCATTGGAAACAGCTCATGAAAAGGCTTCACGTTAATTGGGTTGTTTCTGAGCTAACCCTTGGCCAAATCTGGGATGTTGACTTGCAGAAAAATGAAGCGATTGTCAAGGATGTACTGCTTGTGGCACAAGGGGAGATGGCTTTGGAAGAATTTTTGAAGCAGATAAGAGAAGTGTGGAATACTTATGAACTAGACTTGGTTAATTATCAGAACAAGTGCCGCTTGATCCGTGGCTGGGATGACCTCTTCAACAAGGTCAAAGAACACATCAACAGCGTCTCGGCCATGAAGCTCTCTCCGTATTACAAGGTTTTTGAAGAGGATGCTCTCAGCTGGGAAGATAAGCTGAACAGGATCATGGCTCTCTTTGATGTGTGGATTGATGTGCAGAGGCGGTGGGTCTACCTGGAAGGTATCTTCACAGGCAGTGCAGATATCAAGCACCTGCTGCCAGTGGAAACCCAGCGGTTTCAGAGCATCAGCACTGAGTTTTTGGCTCTAATGAAAAAAGTGTCCAAGTCTCCCCTTGTTATGGATGTTCTGAACATCCAGGGAGTACAGAGGTCTCTGGAAAGATTGGCAGACCTGCTAGGAAAGATCCAGAAAGCATTGGGAGAATATCTGGAAAGAGAGCGGTCATCTTTCCCCAGGTTCTATTTTGTGGGTGATGAAGATTTGCTTGAAATCATTGGAAACAGCAAGAATGTCGCTAAATTACAGAAACACTTCAAGAAGATGTTTGCTGGAGTTTCGAGCATCATCCTGAACGAGGATAACTCTGTTGTTTTGGGTATTTCATCTCGGGAAGGAGAGGAGGTTATGTTTAAAACTCCTGTGTCAATTACTGAACATCCCAAAATCAATGAGTGGCTCACATTGGTAGAAAAGGAGATGAGAGTCACCCTGGCCAAACTGCTTGCTGAGTCTGTTACGGAAGTTGAGATTTTTGGTAAAGCAACTTCAATTGACCCAAATACCTACATCACTTGGATTGATAAATACCAGGCCCAGCTTGTGGTTTTGTCAGCCCAGATAGCCTGGTCTGAGAACGTGGAGACCGCACTGAGCAGCATGGGCGGAGGTGGAGATGCCGCGCCCTTGCACTCTGTGCTGAGCAATGTGGAGGTCACCCTCAATGTGTTAGCAGACTCTGTCCTCATGGAGCAGCCCCCACTCCGAAGGCGGAAGCTAGAACACTTGATTACAGAGTTGGTTCACCAGAGAGATGTTACAAGGTCCTTGATCAAAAGCAAGATTGACAACGCCAAATCTTTTGAATGGCTCAGCCAGATGCGATTTTACTTTGACCCTAAGCAAACTGATGTGTTACAGCAGTTGTCAATTCAAATGGCAAATGCCAAATTTAACTATGGCTTTGAGTACCTGGGTGTTCAGGACAAACTGGTCCAGACCCCCCTCACTGACCGCTGCTATTTGACAATGACACAAGCCTTGGAGGCCAGGCTGGGGGGTTCCCCATTTGGACCTGCTGGAACTGGGAAAACAGAGTCTGTCAAAGCTCTTGGCCATCAGCTTGGACGGTTTGTTTTAGTTTTCAACTGTGATGAAACCTTTGATTTCCAGGCAATGGGCCGGATCTTTGTGGGCCTTTGCCAGGTGGGTGCCTGGGGCTGCTTTGACGAGTTCAACCGCCTGGAGGAGCGGATGCTCTCGGCTGTGTCCCAGCAGGTGCAGTGCATACAGGAAGCACTGCGTGAACATTCCAACCCCAACTACGACAAGACCTCTGCCCCCATTACTTGTGAGCTGCTGAACAAACAAGTCAAGGTGAGCCCGGACATGGCCATCTTCATCACCATGAACCCTGGCTACGCGGGCCGGTCTAACCTTCCTGACAACTTGAAGAAGCTGTTCCGGAGCTTGGCCATGACCAAGCCCGACCGGCAGTTAATCGCCCAGGTCATGCTGTACTCACAGGGTTTCCGCACTGCTGAAGTGCTTGCCAACAAAATCGTCCCGTTTTTTAAACTATGCGATGAGCAGCTCTCTTCCCAAAGCCATTATGACTTCGGTCTTCGGGCTTTGAAGAGTGTGCTGGTGAGTGCAGGCAATGTGAAGAGAGAGAGAATCCAGAAGATAAAGAGGGAGAAAGAGGAACGAGGGGAAGCAGTTGATGAAGGAGAAATTGCTGAAAATCTCCCTGAACAAGAGATTCTGATACAGAGCGTCTGTGAGACGATGGTGCCAAAGCTGGTGGCAGAGGACATCCCGCTGCTCTTCAGCCTCCTGTCGGACGTGTTCCCTGGAGTCCAGTATCACAGGGGTGAGATGACTGCCCTTCGAGAGGAGCTGAAGAAAGTGTGTCAGGAGATGTATTTGACATATGGAGATGGAGAAGAAGTTGGTGGAATGTGGGTTGAAAAGGTTCTCCAGCTCTATCAGATCACCCAGATCAATCATGGCCTGATGATGGTGGGGCCCTCGGGAAGTGGGAAGAGCATGGCCTGGCGTGTCCTGCTGAAGGCATTGGAGAGACTCGAGGGTGTGGAAGGTGTGGCCCATATCATCGACCCCAAGGCCATCAGCAAAGACCACCTCTACGGAACCCTGGACCCCAACACCAGGGAATGGACAGATGGGCTCTTCACACACGTGCTGAGAAAGATCATCGACAGCGTGAGAGGCGAGCTGCAGAAGCGCCAGTGGATCGTCTTCGATGGCGATGTGGATCCAGAGTGGGTTGAGAACTTGAACTCAGTGCTGGATGACAATAAGCTCCTAACTTTGCCCAATGGAGAGCGCCTCAGTCTTCCACCCAATGTGAGAATAATGTTTGAGGTACAGGACTTGAAATACGCGACCTTGGCCACAGTGTCGCGCTGCGGCATGGTCTGGTTCAGTGAGGATGTGCTGAGCACCGACATGATCTTCAACAACTTCCTGGCCAGGCTGCGCAGCATCCCGCTGGATGAAGGGGAGGATGAGGCACAGCGGCGGCGTAAGGGCAAAGAGGATGAGGGGGAGGAGGCCGCTTCCCCCATGCTGCAGATCCAAAGAGATGCAGCTACGATCATGCAACCGTACTTCACGTCCAACGGCCTGGTCACCAAGGCGCTAGAGCACGCCTTCCAGCTGGAGCACATCATGGACCTAACACGCCTGCGCTGCCTGGGCTCGCTCTTCTCCATGCTGCACCAGGCCTGCCGCAACGTGGCGCAGTATAACGCCAACCATCCCGACTTCCCCATGCAGATCGAGCAGCTGGAGCGCTACATTCAGCGATATCTGGTTTATGCCATACTCTGGTCCCTGTCTGGAGACAGCCGGCTAAAAATGAGAGCAGAGCTGGGTGAATACATCAGAAGAATCACGACCGTGCCTCTGCCCACTGCGCCCAACATACCCATTATCGATTATGAGGTGTCCATCAGCGGAGAATGGTCTCCGTGGCAGGCCAAGGTGCCTCAGATTGAAGTGGAGACGCACAAGGTGGCAGCCCCTGATGTCGTCGTGCCAACGCTGGACACAGTCCGCCACGAAGCCCTCTTGTACACTTGGCTGGCCGAACACAAGCCCCTGGTCTTGTGTGGCCCTCCTGGGTCTGGCAAGACCATGACACTCTTCAGCGCCCTCCGGGCCTTGCCTGACATGGAGGTGGTGGGTCTCAACTTCTCCAGTGCTACTACTCCAGAGCTGCTTCTGAAGACTTTTGATCACTACTGCGAGTACAGGCGCACACCTAATGGGGTGGTTTTGGCTCCTGTTCAACTTGGAAAGTGGCTGGTGTTGTTCTGTGATGAAATCAACTTGCCAGATATGGATAAATATGGGACCCAGAGGGTCATATCCTTCATCAGACAGATGGTGGAGCACGGAGGCTTTTACCGTACCTCAGATCAAACATGGGTGAAGCTGGAGAGAATCCAGTTTGTTGGGGCTTGTAATCCCCCCACAGACCCTGGAAGAAAGCCCCTCTCACACAGGTTCCTGCGCCACGTGCCTGTCGTGTATGTGGATTACCCGGGCCCCGCCTCCCTCACACAGATCTACGGCACCTTCAACCGCGCCATGCTGAGGCTCATTCCATCCCTGCGGACGTATGCAGAGCCGCTCACTGCTGCCATGGTGGAGTTCTACACCATGTCTCAGGAGAGATTCACCCAGGATACACAACCTCACTATATCTATTCACCCCGTGAAATGACTAGGTGGGTGAGAGGCATCTTTGAAGCGCTGAGACCTCTGGAGACCCTGCCTGTTGAAGGCCTCATTCGGATTTGGGCACATGAAGCTCTGCGTCTCTTCCAAGATAGACTCGTAGAGGATGAGGAGAGGCGTTGGACTGATGAGAACATCGACACGGTTGCTCTGAAGCACTTCCCTAACATCGACAGAGAGAAGGCAATGAGCCGACCCATCTTGTACAGCAACTGGCTGTCAAAGGATTACATCCCAGTAGACCAAGAAGAGTTAAGAGATTATGTCAAAGCTAGGCTGAAGGTCTTTTATGAAGAAGAACTTGATGTTCCGCTGGTGCTGTTTAATGAAGTCCTAGACCACGTGCTGAGGATTGACAGAATATTCCGTCAACCTCAAGGCCACTTGCTTCTGATTGGTGTTAGTGGAGCAGGAAAAACTACCCTGTCTCGTTTCGTCGCCTGGATGAACGGTTTGAGTGTGTACCAGATTAAGGTCCATAGGAAGTACACAGGGGAAGACTTTGATGAAGATCTACGGACAGTGTTGAGACGTTCTGGCTGTAAAAATGAAAAGATAGCATTTATAATGGATGAATCTAATGTGTTAGATTCTGGATTCCTGGAGCGAATGAATACCCTTCTGGCCAATGGAGAGGTGCCTGGTCTCTTTGAAGGAGACGAGTATGCCACCTTGATGACGCAGTGCAAAGAGGGGGCACAGAAGGAAGGCCTGATGCTGGACTCGCACGAGGAGCTCTACAAGTGGTTCACTAGCCAGGTTATCCGCAACCTCCACGTCGTGTTCACCATGAACCCGTCCTCGGAGGGACTCAAGGACCGGGCAGCTACATCACCAGCACTTTTCAACAGGTGTGTGTTGAATTGGTTTGGAGACTGGTCCACCGAAGCACTGTATCAGGTTGGCAAAGAATTCACAAGTAAGATGGATCTGGAGAAGCCAAATTACATCGTGCCTGATTACATGCCAGTTGTGTATGATAAGCTGCCGCAGCCACCATCCCATCGGGAAGCCATTGTGAACAGCTGTGTGTTTGTTCATCAGACTCTTCACCAGGCGAATGCTCGGCTAGCAAAGCGAGGCGGCAGAACGATGGCCATCACCCCTCGCCACTACCTGGACTTCATCAATCACTATGCCAACCTGTTCCACGAGAAGCGGAGCGAGCTGGAGGAGCAGCAGATGCACTTGAACGTGGGGCTCAGGAAGATCAAAGAGACAGTCGACCAGGTAGAAGAACTGCGTCGTGACTTGAGGATAAAGAGCCAAGAGCTGGAGGTGAAGAATGCAGCAGCCAATGACAAGCTGAAAAAGATGGTGAAAGACCAGCAGGAGGCTGAAAAGAAGAAGGTTATGAGCCAAGAAATCCAGGAACAGCTGCATAAGCAGCAGGAGGTAATTGCAGACAAACAGATGAGTGTCAAAGAAGATCTTGATAAGGTGGAACCTGCCGTCATTGAGGCCCAGAATGCTGTGAAGTCGATCAAGAAGCAGCACCTGGTGGAGGTGAGGTCCATGGCCAACCCTCCTGCTGCTGTGAAGCTGGCGCTGGAGTCCATCTGCCTGCTGCTGGGGGAAAGCACCACAGACTGGAAGCAGATCCGCTCCATCATCATGCGGGAGAACTTCATCCCCACCATCGTCAACTTCTCTGCAGAGGAGATCAGTGACGCCATAAGGGAGAAGATGAAGAAAAATTACATGTCCAATCCAAGTTACAATTATGAAATTGTGAATCGGGCTTCCCTGGCTTGCGGCCCTATGGTGAAATGGGCAATTGCACAGCTTAACTATGCAGACATGTTAAAGAGAGTGGAGCCCCTACGCAATGAGCTGCAGAAGCTGGAAGATGACGCCAAGGACAACCAGCAGAAGGCCAACGAGGTGGAGCAGATGATCCGAGACCTGGAAGCCAGCATCGCCCGCTACAAGGAGGAATACGCCGTCCTGATCTCAGAGGCCCAGGCCATCAAGGCAGACCTGGCAGCTGTCGAGGCAAAAGTAAACCGGAGCACTGCTCTTCTGAAGAGCTTGTCTGCTGAACGTGAACGATGGGAAAAAACAAGTGAAACTTTCAAAAACCAGATGTCCACCATTGCTGGGGACTGTCTCTTGTCAGCTGCGTTCATTGCCTACGCGGGTTACTTTGACCAGCAGATGCGTCAGAACTTGTTCACTACCTGGTCCCATCACCTACAGCAAGCCAACATCCAGTTCCGTACAGATATTGCCAGGACGGAATACCTTTCCAATGCTGATGAGCGTCTTCGCTGGCAGGCCAGCTCCTTGCCTGCTGATGACCTTTGCACAGAAAATGCCATCATGCTGAAACGATTCAATAGGTATCCGCTGATCATTGACCCCTCTGGACAGGCCACAGAATTCATTATGAATGAATATAAGGATCGTAAGATCACACGGACCAGCTTCCTGGATGACGCCTTCAGAAAGAACTTAGAGAGTGCACTGAGATTCGGTAACCCCCTTCTGGTCCAGGATGTGGAAAGCTACGATCCAGTTTTGAACCCGGTGCTGAACCGTGAAGTGCGGCGAACAGGGGGGAGAGTGCTGATCACTCTCGGGGACCAGGACATAGACCTGTCGCCATCGTTTGTCATCTTCCTGTCCACCCGGGATCCAACTGTCGAGTTCCCACCAGATCTCTGTTCCCGGGTTACTTTTGTAAACTTCACAGTTACCCGTAGCAGTTTACAAAGCCAGTGTCTAAATGAAGTACTTAAAGCAGAAAGACCTGATGTGGACGAGAAACGATCTGATCTTCTTAAACTTCAAGGGGAATTTCAGCTCCGTTTGCGTCAGCTGGAAAAATCTCTACTACAAGCTCTGAACGAGGTGAAAGGGCGCATTTTGGATGACGACACGATCATAACCACTCTGGAGAACCTGAAGAGAGAGGCTGCAGAGGTCACCAGGAAAGTTGAGGAGACGGACATTGTCATGCAGGAGGTGGAGACCGTGTCCCAGCAGTACCTCCCGCTCTCCACCGCCTGCAGCAGCATCTACTTCACCATGGAGTCCCTCAAGCAGATACACTTCTTGTACCAGTACTCCCTCCAGTTTTTCCTGGACATTTATCACAACGTCCTATACGAGAACCCGAACCTGAAGGGTGTCACCGACCACACACAGCGCCTGTCCATTATAACAAAGGACCTCTTCCAGGTGGCGTTTAACCGAGTGGCTCGAGGCATGCTGCATCAGGACCACATTACCTTTGCCATGCTGCTGGCAAGAATCAAACTGAAGGGCACCGTGGGGGAGCCCACCTACGATGCAGAATTCCAGCACTTCTTGAGAGGAAATGAGATTGTCCTGAGTGCTGGCTCCACCCCCAGGATCCAGGGCCTGACTGTGGAGCAGGCGGAGGCGGTGGTGAGGCTGAGCTGCCTTCCCGCGTTTAAGGACTTGATTGCAAAGGTTCAGGCAGACGAGCAATTTGGCATCTGGCTGGACAGCAGCTCCCCGGAGCAGACTGTGCCCTACCTCTGGAGTGAAGAAACACCTGCAACACCCATTGGCCAGGCCATCCACCGCCTGCTCCTGATCCAGGCTTTCCGGCCCGATCGCCTGTTGGCCATGGCCCACATGTTTGTTTCAACAAACCTTGGGGAGTCTTTCATGTCCATCATGGAGCAGCCGCTCGACCTGACCCACATTGTGGGCACAGAGGTGAAGCCCAACACTCCTGTCTTAATGTGCTCTGTGCCTGGTTATGATGCCAGTGGACATGTCGAGGACCTTGCAGCCGAGCAGAACACGCAGATCACTTCAATTGCAATCGGCTCTGCAGAAGGCTTTAACCAAGCAGATAAGGCAATAAACACCGCTGTAAAGTCGGGCAGGTGGGTGATGCTGAAGAATGTGCATCTGGCCCCAGGGTGGCTGATGCAGCTGGAGAAGAAGTTGCATTCCCTGCAGCCGCATGCCTGCTTCCGACTCTTCCTCACCATGGAGATCAACCCCAAGGTGCCTGTGAATCTGCTCCGTGCGGGCCGCATCTTTGTGTTCGAGCCACCGCCAGGGGTGAAGGCCAACATGCTGAGGACGTTCAGCAGCATTCCCGTCTCACGGATATGCAAGTCTCCCAACGAGCGTGCCCGCTTGTACTTCCTGCTGGCCTGGTTTCATGCGATCATCCAAGAACGCTTACGATACGCACCACTGGGGTGGTCAAAGAAGTATGAATTTGGAGAGTCTGACCTGCGGTCAGCTTGCGATACGGTGGACACGTGGCTGGATGACACGGCCAAGGGCAGGCAGAACATCTCACCGGATAAGATCCCGTGGTCTGCACTAAAGACCTTAATGGCCCAGTCCATTTATGGCGGGCGCGTGGACAACGAGTTTGACCAGCGTCTGCTCAACACCTTCCTGGAGCGCCTGTTCACAACCAGGAGTTTCGACAGTGAGTTTAAGCTGGCATGCAAGGTCGACGGACATAAAGACATTCAAATGCCAGATGGCATCAGGCGAGAGGAGTTTGTGCAGTGGGTGGAGTTGCTCCCCGACACCCAGACGCCCTCCTGGCTGGGCCTGCCCAACAACGCCGAGAGAGTCCTCCTTACCACACAGGGTGTGGACATGATCAGTAAAATGCTGAAGATGCAGATGTTGGAGGATGAGGACGACCTGGCCTACGCAGAGACTGAGAAGAAGACGAGGACAGACTCCACGTCCGACGGGCGCCCTGCCTGGATGCGGACACTGCACACCACCGCGTCCAACTGGCTGCACCTCATCCCCCAGACGCTGAGCCACCTCAAGCGCACCGTGGAGAATATCAAGGATCCTTTGTTCAGGTTCTTTGAGAGAGAAGTGAAGATGGGCGCAAAGCTGCTTCAGGACGTTCGCCAGGACCTTGCAGATGTCGTCCAGGTGTGCGAAGGAAAGAAGAAGCAGACCAACTACTTGCGCACGCTGATCAACGAGCTAGTGAAAGGGATCTTGCCTCGGAGCTGGTCCCACTACACGGTGCCTGCCGGCATGACCGTCATCCAGTGGGTGTCCGACTTCAGCGAGAGGATCAAACAGCTGCAGAACATCTCACTGGCAGCTGCATCTGGTGGCGCCAAGGAGCTAAAGAACATCCACGTGTGCCTGGGTGGCCTGTTCGTGCCTGAGGCGTACATCACTGCCACCAGGCAGTATGTGGCCCAGGCCAACAGCTGGTCCCTGGAGGAGCTCTGCCTGGAAGTCAACGTCACCACCTCACAGGGCGCCACCCTTGACGCTTGCAGCTTCGGAGTCACGGGTTTGAAACTTCAAGGGGCCACGTGCAACAACAACAAGCTGTCACTGTCCAATGCCATCTCAACCGCCCTTCCCCTGACGCAGCTGCGCTGGGTCAAGCAGACAAACACCGAGAAGAAGGCCAGTGTGGTAACCTTACCTGTCTACCTGAACTTCACCCGTGCAGACCTCATCTTCACCGTGGACTTCGAAATTGCTACAAAGGAGGATCCTCGCAGCTTCTACGAGCGGGGTGTCGCAGTCTTGTGCACAGAGTAAACTTTTCTAGCTGCCCCTTTCTGTAATAGTGAAAGTTGGTATTTAACATTTATTCATTTTTAAAATATTTGGAAGGTCTGAGCTTGTGAAAAGAAAGTGGTTGGTCTGAGGTTGGAGGAAGCTGAATGGAATCTGACGGTTGGGAGTGGTGGAAATTGGAAGGATACCAGGAGGTATTTGGGAAGGCCAATGGCGTGGCTCCTTTGAGGAAATAAAACACTAAGCATGAGCCGGCTCCGCCTCTTCTGTCTCCGCTTTCATCCCAGGGCACA