Transcript asmbl_44408

Sequence
Transcript Sequence for observation asmbl_44408 of TGE0056529:
CTGGCAGTGGCTGCCTTTAGGGCGGAGCCGGCTCCCGCTCTCCTCAGTCTGCGGTGGGCTAGCGGACGGTCCGGCTTCCGGCGGCCGTTTCTGTCTCTTGCTGGCTGTCTCGCTGAGTCGCGGCCGCCTTCTCATCGCTCCTGGAAGGTCCCGAGCGCGACACCATGTCGGAGCCCGGGGGCGGCGGCGGCGAGGACGGCTCGGCCGGATTGGAAGTGTCGGCCGTGCAGAATGTGGCGGACGTGTCGGTGCTGCAGAAGCACCTGCGCAAGCTGGTGCCGCTGCTGCTGGAGGACGGCGGCGAGGCGCCGGCCGCGCTGGAGGCGGCGCTGGAGGAGAAGAGCGCCCTGGAGCAGATGCGCAAGTTCCTTTCGGACCCGCAGGTCCACACGGTGCTGGTGGAGCGCTCCACGCTCAAAGAGGACGTCGGTGATGAAGGAGAAGAAGAAAAAGAATTCATTTCCTATAACATCAACATAGACATTCATTATGGGGTTAAATCCAATAGCTTGGCATTCATTAAACGTACTCCCGTGATTGATGCAGATAAACCCGTGTCTTCTCAGCTCCGGGTCCTTACACTCAGTGAAGACTCGCCCTACGAAACTTTGCATTCTTTCATTAGCAATGCAGTGGCTCCTTTTTTTAAGTCCTACATTAGAGAGTCTGGCAAGGCAGACAGGGATGGTGATAAAATGGCTCCTTCAGTTGAAAAGAAGATTGCAGAACTCGAAATGGGACTCCTTCACTTGCAGCAAAATATTGAAATTCCGGAGATCAGCCTGCCGATTCATCCAATGATCACAAATGTTGCAAAACAGTGTTATGAGCGTGGAGAAAAGCCAAAAGTTACAGACTTTGGTGATAAGGTTGAAGACCCAACATTTCTTAATCAGTTACAATCTGGAGTTAACCGCTGGATCCGAGAAATTCAAAAAGTGACCAAACTGGATCGAGATCCTGCATCAGGAACTGCCTTACAGGAAATTAGTTTTTGGCTAAACTTGGAACGTGCGTTATACCGCATCCAGGAGAAACGGGAGAGCCCGGAAGTTCTCCTGACTCTGGATATCTTGAAACATGGCAAGCGCTTCCATGCCACCGTCAGTTTTGACACTGACACAGGTCTAAAACAGGCTTTGGAAACTGTGAATGACTACAATCCTCTGATGAAAGATTTCCCTCTGAATGATTTGCTGTCTGCCACGGAGCTGGACAAAATAAGACAGGCGCTTGTTGCCATTTTCACACATTTGAGAAAGATCCGAAACACAAAATATCCTATTCAGAGGGCACTGCGTTTGGTGGAGGCAATTTCAAGAGACTTGAGTTCTCAATTACTCAAAGTATTGGGCACTAGGAAATTGATGCATGTTGCTTATGAAGAATTTGAAAAAGTTATGGTAGCATGCTTTGAAGTTTTTCAGACTTGGGATGATGAGTATGAGAAACTTCAGGTATTGTTGAGAGACATCGTCAAAAGAAAAAGGGAAGAAAATCTGAAGATGGTGTGGCGTATCAACCCTGCCCACAGGAAGCTGCAGGCCCGCCTTGACCAGATGAGAAAATTTAGACGCCAGCATGAACAGCTAAGAGCTGTTATCGTCAGGGTCCTGAGGCCACAGGTCACGGCAGTTGCACAACAGAATCAAGGAGAGGTCCCTGAACCCCAAGATATGAAAGTGGCTGAGGTTCTCTTTGATGCTGCAGATGCAAATGCCATTGAGGAAGTAAACCTTGCTTATGAGAACGTCAAGGAAGTGGATGGACTGGATGTTTCCAAAGAGGGCACGGAAGCCTGGGAGGCTGCTATGAAGAGGTACGATGAGAGGATCGACAGAGTGGAGACCCGGATCACCGCTCGCCTTCGGGATCAGCTTGGCACAGCCAAGAATGCCAACGAGATGTTTAGGATTTTCTCCAGGTTTAATGCACTGTTTGTCAGGCCTCACATCCGTGGGGCCATTCGCGAATACCAGACCCAGCTGATCCAGCGCGTGAAAGATGACATTGAGTCTCTTCACGACAAGTTCAAGGTCCAGTACCCACAGAGTCAGGCTTGTAAGATGAGTCACGTTCGTGACTTGCCCCCTGTGTCAGGGTCTATCATCTGGGCTAAACAGATCGACAGGCAGCTGACGGCCTACATGAAGCGGGTGGAAGATGTCCTTGGCAAGGGCTGGGAGAATCACGTGGAGGGGCAGAAGCTGAAGCAGGATGGAGACAGCTTCCGCATGAAGCTCAACACGCAGGAGATCTTTGATGACTGGGCAAGGAAGGTGCAGCAGCGCAACCTCGGTGTCTCGGGGCGCATTTTCACCATCGAAAGTACTCGGGTTCGGGGCCGAACTGGAAATGTGCTTAAGCTGAAAGTTAACTTTCTTCCTGAGATTATCACACTATCCAAAGAAGTCCGGAACCTCAAATGGCTTGGTTTCCGCGTCCCACTGGCGATTGTGAACAAAGCCCATCAAGCAAACCAGCTTTACCCGTTTGCCATCTCACTGATCGAGAGCGTTCGTACCTATGAACGGACCTGCGAGAAGGTGGAGGAGCGGAACACCATTTCCCTTTTGGTGGCTGGCTTGAAAAAGGAAGTGCAGGCCCTGATCGCAGAAGGCATTGCGTTGGTGTGGGAGTCCTACAAACTTGACCCATATGTACAGCGCTTAGCAGAGACTGTCTTCAACTTCCAAGAAAAGGTGGATGATCTGCTGATCATTGAAGAAAAAATAGACCTAGAAGTCCGTTCCTTGGAAACTTGTATGTATGACCATAAGACATTCTCGGAAATCTTGAACAGAGTCCAGAAAGCAGTGGATGACTTAAATCTGCACTCCTATTCCAATTTGCCCATCTGGGTCAACAAGCTTGACATGGAGATTGAAAGAATATTGGGCGTCCGTCTGCAAGCTGGCCTGAGAGCTTGGACGCAGGTTCTTCTTGGACAAGCTGAAGATAAAGCAGAAGTTGACATGGACACAGATGCTCCACAAGTTAGTCACAAGCCTGGTGGAGAGCCAAAGATCAAAAATGTCGTTCATGAGCTAAGAATAACCAATCAGGTAATCTACTTGAATCCACCAATTGAAGAGTGCAGATACAAGCTGTATCAGGAAATGTTTGCCTGGAAGATGGTTGTACTGTCTCTCCCCAGGATCCAGAGTCAGAGGTACCAGGTGGGTGTACATTACGAATTGACTGAGGAAGAGAAATTCTATCGGAATGCTTTAACACGGATGCCTGATGGCCCTGTTGCCCTGGAAGAGTCGTATTCTGCTGTCATGGGCATTGTATCTGAAGTTGAACAGTATGTCAAGGTTTGGCTTCAGTATCAGTGTTTATGGGATATGCAAGCTGAAAACATCTATAACAGACTTGGAGAAGATCTCAACAAATGGCAGGCTCTCCTGGTCCAAATAAGGAAGGCCAGAGGAACCTTTGACAATGCAGAAACCAAGAAAGAGTTTGGACCAGTAGTTATAGATTATGGCAAGGTACAATCTAAGGTGAACTTGAAATATGACTCTTGGCATAAGGAGGTTCTTAGCAAATTTGGGCAGATGCTAGGATCAAACATGACGGAATTCCATTCCCAGATCTCAAAGTCCCGCCAAGAGTTGGAGCAGCACTCAGTAGACACGGCCAGCACCTCCGATGCAGTGACCTTCATCACCTATGTGCAGTCTTTGAAACGGAAGATCAAGCAGTTTGAGAAGCAAGTTGAGCTCTACCGCAATGGCCAGCGCTTACTGGAAAAGCAAAGGTTCCAGTTCCCACCTTCCTGGCTTTATATTGACAACATCGAGGGAGAGTGGGGAGCCTTCAATGACATCATGCGGCGAAAGGACTCTGCCATTCAGCAGCAGGTGGCAAACCTGCAAATGAAGATTGTCCAGGAGGATCGGGCCGTGGAAAGCCGCACCACCGACCTGCTGACTGACTGGGAGAAGACCAAGCCTGTCACGGGCAACCTTCGCCCAGAAGAGGCACTTCAGGCTCTCACCATATATGAGGGGAAGTTTGGTAGGCTGAAGGACGACAGAGAGAAGTGTGCAAAGGCCAAGGAGGCGCTGGAATTGACAGATACTGGGCTTCTCAGTGGCAGTGAAGAGCGCGTGCAGGTGGCCTTAGAAGAATTACAGGACCTCAAAGGCGTTTGGTCAGAACTTTCTAAGGTTTGGGAGCAAATCGATCAGATGAAGGAGCAACCCTGGGTTTCAGTACAGCCTCGAAAGCTTCGACAAAATTTGGATGCCCTCCTGAACCAGCTGAAAAGCTTCCCTGCCCGGTTGCGACAGTATGCGTCCTATGAGTTTGTTCAGAGGCTTCTGAAAGGTTACATGAAGATAAATATGCTGGTGATTGAACTGAAATCCGAAGCACTTAAAGACCGCCATTGGAAACAGCTCATGAAAAGGCTTCACGTTAATTGGGTTGTTTCTGAGCTAACCCTTGGCCAAATCTGGGATGTTGACTTGCAGAAAAATGAAGCGATTGTCAAGGATGTACTGCTTGTGGCACAAGGGGAGATGGCTTTGGAAGAATTTTTGAAGCAGATAAGAGAAGTGTGGAATACTTATGAACTAGACTTGGTTAATTATCAGAACAAGTGCCGCTTGATCCGTGGCTGGGATGACCTCTTCAACAAGGTCAAAGAACACATCAACAGCGTCTCGGCCATGAAGCTCTCTCCGTATTACAAGGTTTTTGAAGAGGATGCTCTCAGCTGGGAAGATAAGCTGAACAGGATCATGGCTCTCTTTGATGTGTGGATTGATGTGCAGAGGCGGTGGGTCTACCTGGAAGGTATCTTCACAGGCAGTGCAGATATCAAGCACCTGCTGCCAGTGGAAACCCAGCGGTTTCAGAGCATCAGCACTGAGTTTTTGGCTCTAATGAAAAAAGTGTCCAAGTCTCCCCTTGTTATGGATGTTCTGAACATCCAGGGAGTACAGAGGTCTCTGGAAAGATTGGCAGACCTGCTAGGAAAGATCCAGAAAGCATTGGGAGAATATCTGGAAAGAGAGCGGTCATCTTTCCCCAGGTTCTATTTTGTGGGTGATGAAGATTTGCTTGAAATCATTGGAAACAGCAAGAATGTCGCTAAATTACAGAAACACTTCAAGAAGATGTTTGCTGGAGTTTCGAGCATCATCCTGAACGAGGATAACTCTGTTGTTTTGGGTATTTCATCTCGGGAAGGAGAGGAGGTTATGTTTAAAACTCCTGTGTCAATTACTGAACATCCCAAAATCAATGAGTGGCTCACATTGGTAGAAAAGGAGATGAGAGTCACCCTGGCCAAACTGCTTGCTGAGTCTGTTACGGAAGTTGAGATTTTTGGTAAAGCAACTTCAATTGACCCAAATACCTACATCACTTGGATTGATAAATACCAGGCCCAGCTTGTGGTTTTGTCAGCCCAGATAGCCTGGTCTGAGAACGTGGAGACCGCACTGAGCAGCATGGGCGGAGGTGGAGATGCCGCGCCCTTGCACTCTGTGCTGAGCAATGTGGAGGTCACCCTCAATGTGTTAGCAGACTCTGTCCTCATGGAGCAGCCCCCACTCCGAAGGCGGAAGCTAGAACACTTGATTACAGAGTTGGTTCACCAGAGAGATGTTACAAGGTCCTTGATCAAAAGCAAGATTGACAACGCCAAATCTTTTGAATGGCTCAGCCAGATGCGATTTTACTTTGACCCTAAGCAAACTGATGTGTTACAGCAGTTGTCAATTCAAATGGCAAATGCCAAATTTAACTATGGCTTTGAGTACCTGGGTGTTCAGGACAAACTGGTCCAGACCCCCCTCACTGACCGCTGCTATTTGACAATGACACAAGCCTTGGAGGCCAGGCTGGGGGGTTCCCCATTTGGACCTGCTGGAACTGGGAAAACAGAGTCTGTCAAAGCTCTTGGCCATCAGCTTGGACGGTTTGTTTTAGTTTTCAACTGTGATGAAACCTTTGATTTCCAGGCAATGGGCCGGATCTTTGTGGGCCTTTGCCAGGTGGGTGCCTGGGGCTGCTTTGACGAGTTCAACCGCCTGGAGGAGCGGATGCTCTCGGCTGTGTCCCAGCAGGTGCAGTGCATACAGGAAGCACTGCGTGAACATTCCAACCCCAACTACGACAAGACCTCTGCCCCCATTACTTGTGAGCTGCTGAACAAACAAGTCAAGGTGAGCCCGGACATGGCCATCTTCATCACCATGAACCCTGGCTACGCGGGCCGGTCTAACCTTCCTGACAACTTGAAGAAGCTGTTCCGGAGCTTGGCCATGACCAAGCCCGACCGGCAGTTAATCGCCCAGGTCATGCTGTACTCACAGGGTTTCCGCACTGCTGAAGTGCTTGCCAACAAAATCGTCCCGTTTTTTAAACTATGCGATGAGCAGCTCTCTTCCCAAAGCCATTATGACTTCGGTCTTCGGGCTTTGAAGAGTGTGCTGGTGAGTGCAGGCAATGTGAAGAGAGAGAGAATCCAGAAGATAAAGAGGGAGAAAGAGGAACGAGGGGAAGCAGTTGATGAAGGAGAAATTGCTGAAAATCTCCCTGAACAAGAGATTCTGATACAGAGCGTCTGTGAGACGATGGTGCCAAAGCTGGTGGCAGAGGACATCCCGCTGCTCTTCAGCCTCCTGTCGGACGTGTTCCCTGGAGTCCAGTATCACAGGGGTGAGATGACTGCCCTTCGAGAGGAGCTGAAGAAAGTGTGTCAGGAGATGTATTTGACATATGGAGATGGAGAAGAAGTTGGTGGAATGTGGGTTGAAAAGGTTCTCCAGCTCTATCAGATCACCCAGATCAATCATGGCCTGATGATGGTGGGGCCCTCGGGAAGTGGGAAGAGCATGGCCTGGCGTGTCCTGCTGAAGGCATTGGAGAGACTCGAGGGTGTGGAAGGTGTGGCCCATATCATCGACCCCAAGGCCATCAGCAAAGACCACCTCTACGGAACCCTGGACCCCAACACCAGGGAATGGACAGATGGGCTCTTCACACACGTGCTGAGAAAGATCATCGACAGCGTGAGAGGCGAGCTGCAGAAGCGCCAGTGGATCGTCTTCGATGGCGATGTGGATCCAGAGTGGGTTGAGAACTTGAACTCAGTGCTGGATGACAATAAGCTCCTAACTTTGCCCAATGGAGAGCGCCTCAGTCTTCCACCCAATGTGAGAATAATGTTTGAGGTACAGGACTTGAAATACGCGACCTTGGCCACAGTGTCGCGCTGCGGCATGGTCTGGTTCAGTGAGGATGTGCTGAGCACCGACATGATCTTCAACAACTTCCTGGCCAGGCTGCGCAGCATCCCGCTGGATGAAGGGGAGGATGAGGCACAGCGGCGGCGTAAGGGCAAAGAGGATGAGGGGGAGGAGGCCGCTTCCCCCATGCTGCAGATCCAAAGAGATGCAGCTACGATCATGCAACCGTACTTCACGTCCAACGGCCTGGTCACCAAGGCGCTAGAGCACGCCTTCCAGCTGGAGCACATCATGGACCTAACACGCCTGCGCTGCCTGGGCTCGCTCTTCTCCATGCTGCACCAGGCCTGCCGCAACGTGGCGCAGTATAACGCCAACCATCCCGACTTCCCCATGCAGATCGAGCAGCTGGAGCGCTACATTCAGCGATATCTGGTTTATGCCATACTCTGGTCCCTGTCTGGAGACAGCCGGCTAAAAATGAGAGCAGAGCTGGGTGAATACATCAGAAGAATCACGACCGTGCCTCTGCCCACTGCGCCCAACATACCCATTATCGATTATGAGGTGTCCATCAGCGGAGAATGGTCTCCGTGGCAGGCCAAGGTGCCTCAGATTGAAGTGGAGACGCACAAGGTGGCAGCCCCTGATGTCGTCGTGCCAACGCTGGACACAGTCCGCCACGAAGCCCTCTTGTACACTTGGCTGGCCGAACACAAGCCCCTGGTCTTGTGTGGCCCTCCTGGGTCTGGCAAGACCATGACACTCTTCAGCGCCCTCCGGGCCTTGCCTGACATGGAGGTGGTGGGTCTCAACTTCTCCAGTGCTACTACTCCAGAGCTGCTTCTGAAGACTTTTGATCACTACTGCGAGTACAGGCGCACACCTAATGGGGTGGTTTTGGCTCCTGTTCAACTTGGAAAGTGGCTGGTGTTGTTCTGTGATGAAATCAACTTGCCAGATATGGATAAATATGGGACCCAGAGGGTCATATCCTTCATCAGACAGATGGTGGAGCACGGAGGCTTTTACCGTACCTCAGATCAAACATGGGTGAAGCTGGAGAGAATCCAGTTTGTTGGGGCTTGTAATCCCCCCACAGACCCTGGAAGAAAGCCCCTCTCACACAGGTTCCTGCGCCACGTGCCTGTCGTGTATGTGGATTACCCGGGCCCCGCCTCCCTCACACAGATCTACGGCACCTTCAACCGCGCCATGCTGAGGCTCATTCCATCCCTGCGGACGTATGCAGAGCCGCTCACTGCTGCCATGGTGGAGTTCTACACCATGTCTCAGGAGAGATTCACCCAGGATACACAACCTCACTATATCTATTCACCCCGTGAAATGACTAGGTGGGTGAGAGGCATCTTTGAAGCGCTGAGACCTCTGGAGACCCTGCCTGTTGAAGGCCTCATTCGGATTTGGGCACATGAAGCTCTGCGTCTCTTCCAAGATAGACTCGTAGAGGATGAGGAGAGGCGTTGGACTGATGAGAACATCGACACGGTTGCTCTGAAGCACTTCCCTAACATCGACAGAGAGAAGGCAATGAGCCGACCCATCTTGTACAGCAACTGGCTGTCAAAGGATTACATCCCAGTAGACCAAGAAGAGTTAAGAGATTATGTCAAAGCTAGGCTGAAGGTCTTTTATGAAGAAGAACTTGATGTTCCGCTGGTGCTGTTTAATGAAGTCCTAGACCACGTGCTGAGGATTGACAGAATATTCCGTCAACCTCAAGGCCACTTGCTTCTGATTGGTGTTAGTGGAGCAGGAAAAACTACCCTGTCTCGTTTCGTCGCCTGGATGAACGGTTTGAGTGTGTACCAGATTAAGGTCCATAGGAAGTACACAGGGGAAGACTTTGATGAAGATCTACGGACAGTGTTGAGACGTTCTGGCTGTAAAAATGAAAAGATAGCATTTATAATGGATGAATCTAATGTGTTAGATTCTGGATTCCTGGAGCGAATGAATACCCTTCTGGCCAATGGAGAGGTGCCTGGTCTCTTTGAAGGAGACGAGTATGCCACCTTGATGACGCAGTGCAAAGAGGGGGCACAGAAGGAAGGCCTGATGCTGGACTCGCACGAGGAGCTCTACAAGTGGTTCACTAGCCAGGTTATCCGCAACCTCCACGTCGTGTTCACCATGAACCCGTCCTCGGAGGGACTCAAGGACCGGGCAGCTACATCACCAGCACTTTTCAACAGGTGTGTGTTGAATTGGTTTGGAGACTGGTCCACCGAAGCACTGTATCAGGTTGGCAAAGAATTCACAAGTAAGATGGATCTGGAGAAGCCAAATTACATCGTGCCTGATTACATGCCAGTTGTGTATGATAAGCTGCCGCAGCCACCATCCCATCGGGAAGCCATTGTGAACAGCTGTGTGTTTGTTCATCAGACTCTTCACCAGGCGAATGCTCGGCTAGCAAAGCGAGGCGGCAGAACGATGGCCATCACCCCTCGCCACTACCTGGACTTCATCAATCACTATGCCAACCTGTTCCACGAGAAGCGGAGCGAGCTGGAGGAGCAGCAGATGCACTTGAACGTGGGGCTCAGGAAGATCAAAGAGACAGTCGACCAGGTAGAAGAACTGCGTCGTGACTTGAGGATAAAGAGCCAAGAGCTGGAGGTGAAGAATGCAGCAGCCAATGACAAGCTGAAAAAGATGGTGAAAGACCAGCAGGAGGCTGAAAAGAAGAAGGTTATGAGCCAAGAAATCCAGGAACAGCTGCATAAGCAGCAGGAGGTAATTGCAGACAAACAGATGAGTGTCAAAGAAGATCTTGATAAGGTGGAACCTGCCGTCATTGAGGCCCAGAATGCTGTGAAGTCGATCAAGAAGCAGCACCTGGTGGAGGTGAGGTCCATGGCCAACCCTCCTGCTGCTGTGAAGCTGGCGCTGGAGTCCATCTGCCTGCTGCTGGGGGAAAGCACCACAGACTGGAAGCAGATCCGCTCCATCATCATGCGGGAGAACTTCATCCCCACCATCGTCAACTTCTCTGCAGAGGAGATCAGTGACGCCATAAGGGAGAAGATGAAGAAAAATTACATGTCCAATCCAAGTTACAATTATGAAATTGTGAATCGGGCTTCCCTGGCTTGCGGCCCTATGGTGAAATGGGCAATTGCACAGCTTAACTATGCAGACATGTTAAAGAGAGTGGAGCCCCTACGCAATGAGCTGCAGAAGCTGGAAGATGACGCCAAGGACAACCAGCAGAAGGCCAACGAGGTGGAGCAGATGATCCGAGACCTGGAAGCCAGCATCGCCCGCTACAAGGAGGAATACGCCGTCCTGATCTCAGAGGCCCAGGCCATCAAGGCAGACCTGGCAGCTGTCGAGGCAAAAGTAAACCGGAGCACTGCTCTTCTGAAGAGCTTGTCTGCTGAACGTGAACGATGGGAAAAAACAAGTGAAACTTTCAAAAACCAGATGTCCACCATTGCTGGGGACTGTCTCTTGTCAGCTGCGTTCATTGCCTACGCGGGTTACTTTGACCAGCAGATGCGTCAGAACTTGTTCACTACCTGGTCCCATCACCTACAGCAAGCCAACATCCAGTTCCGTACAGATATTGCCAGGACGGAATACCTTTCCAATGCTGATGAGCGTCTTCGCTGGCAGGCCAGCTCCTTGCCTGCTGATGACCTTTGCACAGAAAATGCCATCATGCTGAAACGATTCAATAGGTATCCGCTGATCATTGACCCCTCTGGACAGGCCACAGAATTCATTATGAATGAATATAAGGATCGTAAGATCACACGGACCAGCTTCCTGGATGACGCCTTCAGAAAGAACTTAGAGAGTGCACTGAGATTCGGTAACCCCCTTCTGGTCCAGGATGTGGAAAGCTACGATCCAGTTTTGAACCCGGTGCTGAACCGTGAAGTGCGGCGAACAGGGGGGAGAGTGCTGATCACTCTCGGGGACCAGGACATAGACCTGTCGCCATCGTTTGTCATCTTCCTGTCCACCCGGGATCCAACTGTCGAGTTCCCACCAGATCTCTGTTCCCGGGTTACTTTTGTAAACTTCACAGTTACCCGTAGCAGTTTACAAAGCCAGTGTCTAAATGAAGTACTTAAAGCAGAAAGACCTGATGTGGACGAGAAACGATCTGATCTTCTTAAACTTCAAGGGGAATTTCAGCTCCGTTTGCGTCAGCTGGAAAAATCTCTACTACAAGCTCTGAACGAGGTGAAAGGGCGCATTTTGGATGACGACACGATCATAACCACTCTGGAGAACCTGAAGAGAGAGGCTGCAGAGGTCACCAGGAAAGTTGAGGAGACGGACATTGTCATGCAGGAGGTGGAGACCGTGTCCCAGCAGTACCTCCCGCTCTCCACCGCCTGCAGCAGCATCTACTTCACCATGGAGTCCCTCAAGCAGATACACTTCTTGTACCAGTACTCCCTCCAGTTTTTCCTGGACATTTATCACAACGTCCTATACGAGAACCCGAACCTGAAGGGTGTCACCGACCACACACAGCGCCTGTCCATTATAACAAAGGACCTCTTCCAGGTGGCGTTTAACCGAGTGGCTCGAGGCATGCTGCATCAGGACCACATTACCTTTGCCATGCTGCTGGCAAGAATCAAACTGAAGGGCACCGTGGGGGAGCCCACCTACGATGCAGAATTCCAGCACTTCTTGAGAGGAAATGAGATTGTCCTGAGTGCTGGCTCCACCCCCAGGATCCAGGGCCTGACTGTGGAGCAGGCGGAGGCGGTGGTGAGGCTGAGCTGCCTTCCCGCGTTTAAGGACTTGATTGCAAAGGTTCAGGCAGACGAGCAATTTGGCATCTGGCTGGACAGCAGCTCCCCGGAGCAGACTGTGCCCTACCTCTGGAGTGAAGAAACACCTGCAACACCCATTGGCCAGGCCATCCACCGCCTGCTCCTGATCCAGGCTTTCCGGCCCGATCGCCTGTTGGCCATGGCCCACATGTTTGTTTCAACAAACCTTGGGGAGTCTTTCATGTCCATCATGGAGCAGCCGCTCGACCTGACCCACATTGTGGGCACAGAGGTGAAGCCCAACACTCCTGTCTTAATGTGCTCTGTGCCTGGTTATGATGCCAGTGGACATGTCGAGGACCTTGCAGCCGAGCAGAACACGCAGATCACTTCAATTGCAATCGGCTCTGCAGAAGGCTTTAACCAAGCAGATAAGGCAATAAACACCGCTGTAAAGTCGGGCAGGTGGGTGATGCTGAAGAATGTGCATCTGGCCCCAGGGTGGCTGATGCAGCTGGAGAAGAAGTTGCATTCCCTGCAGCCGCATGCCTGCTTCCGACTCTTCCTCACCATGGAGATCAACCCCAAGGTGCCTGTGAATCTGCTCCGTGCGGGCCGCATCTTTGTGTTCGAGCCACCGCCAGGGGTGAAGGCCAACATGCTGAGGACGTTCAGCAGCATTCCCGTCTCACGGATATGCAAGTCTCCCAACGAGCGTGCCCGCTTGTACTTCCTGCTGGCCTGGTTTCATGCGATCATCCAAGAACGCTTACGATACGCACCACTGGGGTGGTCAAAGAAGTATGAATTTGGAGAGTCTGACCTGCGGTCAGCTTGCGATACGGTGGACACGTGGCTGGATGACACGGCCAAGGGCAGGCAGAACATCTCACCGGATAAGATCCCGTGGTCTGCACTAAAGACCTTAATGGCCCAGTCCATTTATGGCGGGCGCGTGGACAACGAGTTTGACCAGCGTCTGCTCAACACCTTCCTGGAGCGCCTGTTCACAACCAGGAGTTTCGACAGTGAGTTTAAGCTGGCATGCAAGGTCGACGGACATAAAGACATTCAAATGCCAGATGGCATCAGGCGAGAGGAGTTTGTGCAGTGGGTGGAGTTGCTCCCCGACACCCAGACGCCCTCCTGGCTGGGCCTGCCCAACAACGCCGAGAGAGTCCTCCTTACCACACAGGGTGTGGACATGATCAGTAAAATGCTGAAGATGCAGATGTTGGAGGATGAGGACGACCTGGCCTACGCAGAGACTGAGAAGAAGACGAGGACAGACTCCACGTCCGACGGGCGCCCTGCCTGGATGCGGACACTGCACACCACCGCGTCCAACTGGCTGCACCTCATCCCCCAGACGCTGAGCCACCTCAAGCGCACCGTGGAGAATATCAAGGATCCTTTGTTCAGGTTCTTTGAGAGAGAAGTGAAGATGGGCGCAAAGCTGCTTCAGGACGTTCGCCAGGACCTTGCAGATGTCGTCCAGGTGTGCGAAGGAAAGAAGAAGCAGACCAACTACTTGCGCACGCTGATCAACGAGCTAGTGAAAGGGATCTTGCCTCGGAGCTGGTCCCACTACACGGTGCCTGCCGGCATGACCGTCATCCAGTGGGTGTCCGACTTCAGCGAGAGGATCAAACAGCTGCAGAACATCTCACTGGCAGCTGCATCTGGTGGCGCCAAGGAGCTAAAGAACATCCACGTGTGCCTGGGTGGCCTGTTCGTGCCTGAGGCGTACATCACTGCCACCAGGCAGTATGTGGCCCAGGCCAACAGCTGGTCCCTGGAGGAGCTCTGCCTGGAAGTCAACGTCACCACCTCACAGGGCGCCACCCTTGACGCTTGCAGCTTCGGAGTCACGGGTTTGAAACTTCAAGGGGCCACGTGCAACAACAACAAGCTGTCACTGTCCAATGCCATCTCAACCGCCCTTCCCCTGACGCAGCTGCGCTGGGTCAAGCAGACAAACACCGAGAAGAAGGCCAGTGTGGTAACCTTACCTGTCTACCTGAACTTCACCCGTGCAGACCTCATCTTCACCGTGGACTTCGAAATTGCTACAAAGGAGGATCCTCGCAGCTTCTACGAGCGGGGTGTCGCAGTCTTGTGCACAGAGTAAACTTTTCTAGCTGCCCCTTTCTGTAATAGTGAAAGTTGGTATTTAACATTTATTCATTTTTAAAATATTTGGAAGGTCTGAGCTTGTGAAAAGAAAGTGGTTGGTCTGAGGTTGGAGGAAGCTGAATGGAATCTGACGGTTGGGAGTGGTGGAAATTGGAAGGATACCAGGAGGTATTTGGGAAGGCCAATGGCGTGGCTCCTTTGAGGAAATAAAACACTAAGCATGAGCCGGCTCCGCCTCTTCTGTCTCCGCTTTCATCCCAGGGCACA