Transcript asmbl_43753

Sequence
Transcript Sequence for observation asmbl_43753 of TGE0000365:
CCACGTGGGGGCTCAGCGTGCACCCTTCTTTGTGCTCGGGTTAGGAGGAGCTAGGCTGCCATCGGGCCGGTGCAGATACGGGGTTGCTCTTTTGCTCATAAGAGGGGCTTCGCTGGCAGTCTGAACGGCAAGCTTGAGCAACGCGGTAAAAATATTGCTTCGGTGGGTGACGCGGTACAGCTGCCCAAGGGCGTTCGTAACGGGAATGCCGAAGCGTGGGAAAAAGGGAGCGGTGGCGGAAGACGGGGATGAGCTCAGGACAGAGCCAGAGGCCAAGAAGAGTAAGACGGCCGCAAAGAAAAATGACAAAGAGGCAGCAGGAGAGGGCCCAGCCCTGTATGAGGACCCCCCAGATCAGAAAACCTCACCCAGTGGCAAACCTGCCACACTCAAGATCTGCTCTTGGAATGTGGATGGGCTTCGAGCCTGGATTAAGAAGAAAGGATTAGATTGGGTAAAGGAAGAAGCCCCAGATATACTGTGCCTTCAAGAGACCAAATGTTCAGAGAACAAACTACCAGCTGAACTTCAGGAGCTGCCTGGACTCTCTCATCAATACTGGTCAGCTCCTTCGGACAAGGAAGGGTACAGTGGCGTGGGCCTGCTTTCCCGCCAGTGCCCACTCAAAGTTTCTTACGGCATAGGCGATGAGGAGCATGATCAGGAAGGCCGGGTGATTGTGGCTGAATTTGACTCGTTTGTGCTGGTAACAGCATATGTACCTAATGCAGGCCGAGGTCTGGTACGACTGGAGTACCGGCAGCGCTGGGATGAAGCCTTTCGCAAGTTCCTGAAGGGCCTGGCTTCCCGAAAGCCCCTTGTGCTGTGTGGAGACCTCAATGTGGCACATGAAGAAATTGACCTTCGCAACCCCAAGGGGAACAAAAAGAATGCTGGCTTCACGCCACAAGAGCGCCAAGGCTTCGGGGAATTACTGCAGGCTGTGCCACTGGCTGACAGCTTTAGGCACCTCTACCCCAACACACCCTATGCCTACACCTTTTGGACTTATATGATGAATGCTCGATCCAAGAATGTTGGTTGGCGCCTTGATTACTTTTTGTTGTCCCACTCTCTGTTACCTGCATTGTGTGACAGCAAGATCCGTTCCAAGGCCCTCGGCAGTGATCACTGTCCTATCACCCTATACCTAGCACTGTGACACCACCCCTAAATCACTTTGAGCCTGGGAAATAAGCCCCCTCAACTACCATTCCTTCTTTAAACACTCTTCAGAGAAATCTGCATTCTATTTCTCATGTATAAAACTAGGAATCCTCCAACCAGGCTCCTGTGATAGAGTTCTTTTAAGCCCAAGATTTTTTATTTGAGGGTTTTTTGTTTTTTAAAAAAAAATTGAACAAAGACTACTAATGACTTTGTTTGAATTATCCACATGAAAATAAAGAGCCATAGTTTCA