Transcript asmbl_38126

Sequence
Transcript Sequence for observation asmbl_38126 of TGE0056205:
CGCCAACAAATTGGGGAGCTCGGCCCGCCGCGCTCAGGTCTCCGCTTGGAGCCGCCGCACCCGGGACGGTGCGTAGCGCTGGAAGTCCGGCCTTCCGAGAGCTAGCTGTCCGCCGCGGCCCCCGCACGCCGGGCAGCCGTCCCTCGCCGCCTCGGGCGCGCCACCATGGGGCCCCGGCTCAGCGTCTGGCTGCTGCTGCTGCCCGCCGCCCTTCTGCTCCACGAGGAGCACAGCCGGGCCGCTGCGAAGGGTGGCTGTGCTGGCTCTGGCTGTGGCAAATGTGACTGCCATGGAGTGAAGGGACAAAAGGGTGAAAGAGGCCTCCCGGGGTTACAAGGTGTCATTGGGTTTCCTGGAATGCAAGGACCTGAGGGGCCACAGGGACCACCAGGACAAAAGGGTGATACTGGAGAACCAGGACTACCTGGAACAAAAGGGACAAGAGGACCTCCGGGAGCATCTGGCTACCCTGGAAACCCAGGACTTCCCGGAATTCCTGGCCAAGACGGCCCGCCAGGCCCCCCAGGTATTCCAGGATGCAATGGCACAAAGGGGGAGAGAGGGCCGCTCGGGCCTCCTGGCTTGCCTGGTTTCGCTGGAAATCCCGGACCACCAGGCTTACCAGGGATGAAGGGTGATCCAGGTGAGATACTTGGCCATGTGCCCGGGATGCTGTTGAAAGGTGAAAGAGGATTTCCCGGAATCCCAGGGACTCCAGGCCCACCAGGACTGCCAGGGCTTCAAGGTCCTGTTGGGCCTCCAGGATTTACCGGACCACCAGGTCCCCCAGGCCCTCCCGGCCCTCCAGGTGAAAAGGGACAAATGGGCTTAAGTTTTCAAGGACCAAAAGGTGACAAGGGTGACCAAGGGGTCAGTGGGCCTCCAGGAGTACCAGGACAAGCTCAAGTTCAAGAAAAAGGAGACTTCGCCACCAAGGGAGAAAAGGGCCAAAAAGGTGAACCTGGATTTCAGGGGATGCCAGGGGTCGGAGAGAAAGGTGAACCCGGAAAACCAGGACCCAGAGGCAAACCCGGAAAAGATGGTGACAAAGGGGAAAAAGGGAGTCCCGGTTTTCCTGGTGAACCCGGGTACCCAGGACTCATAGGCCGCCAGGGCCCGCAGGGAGAAAAGGGTGAAGCAGGTCCTCCTGGCCCACCTGGAATTGTTATAGGCACAGGACCTTTGGGAGAAAAAGGAGAGAGGGGCTACCCTGGAACTCCGGGGCCAAGAGGAGAGCCAGGCCCAAAAGGTTTCCCAGGACTACCAGGCCAACCCGGACCTCCAGGCCTCCCTGTACCTGGGCAGGCTGGTGCCCCTGGCTTCCCTGGTGAAAGAGGAGAAAAAGGTGACCGAGGATTTCCTGGTACATCTCTGCCAGGACCAAGTGGAAGAGATGGGCTCCCGGGTCCTCCTGGTTCCCCTGGGCCCCCTGGGCAGCCTGGCTACACAAATGGAATTGTGGAATGTCAGCCCGGACCTCCAGGTGACCAGGGTCCTCCTGGAATTCCAGGGCAGCCAGGATTTATAGGCGAAATTGGAGAGAAAGGTCAAAAAGGAGAGAGTTGCCTCATCTGTGATATAGACGGATATCGGGGGCCTCCCGGGCCACAGGGACCCCCGGGAGAAATAGGTTTCCCAGGGCAGCCAGGGGCCAAGGGCGACAGAGGTTTGCCTGGCAGAGATGGTGTTGCAGGAGTGCCAGGCCCTCAAGGTACACCAGGGCTGATAGGCCAGCCAGGAGCCAAGGGGGAGCCTGGTGAGTTTTATTTCGACTTGCGGCTCAAAGGTGACAAAGGAGACCCAGGCTTTCCAGGACAGCCCGGCATGCCAGGGAGAGCGGGTTCTCCTGGAAGAGATGGCCATCCGGGTCTTCCTGGCCCCAAGGGCTCGCCGGGTTCTGTAGGATTGAAAGGAGAGCGTGGCCCCCCTGGAGGAGTTGGATTCCCAGGCAGTCGTGGTGACACCGGCCCCCCTGGGCCTCCAGGATATGGTCCTGCTGGTCCCATTGGTGACAAAGGACAAGCAGGCTTTCCTGGAGGCCCTGGATCCCCAGGCCTGCCAGGTCCAAAGGGTGAACCAGGAAAAATTGTTCCTTTACCAGGCCCCCCTGGAGCAGAAGGACTGCCGGGGTCCCCAGGCTTCCCAGGTCCCCAAGGAGACCGAGGCTTTCCCGGAACCCCAGGAAGGCCAGGCCTGCCAGGAGAGAAGGGCGCTGTGGGCCAGCCAGGCATTGGATTTCCAGGGCCCCCCGGCCCCAAAGGTGTTGACGGCTTACCTGGAGACATGGGGCCACCGGGGACTCCAGGTCGCCCGGGATTTAATGGCTTACCTGGGAACCCAGGTGTGCAGGGCCAGAAGGGAGAGCCTGGAGTTGGTCTACCGGGACTCAAAGGTTTGCCAGGTCTTCCCGGCATTCCTGGCACACCCGGGGAGAAGGGGAGCATTGGGGTACCAGGCGTTCCTGGAGAACATGGAGCGATCGGACCCCCTGGGCTTCAGGGGATCAGAGGTGAACCGGGACCTCCTGGATTGCCAGGCTCCGTGGGGTCTCCAGGAGTTCCAGGAATAGGCCCCCCTGGAGCTAGGGGTCCCCCTGGAGGACAGGGACCACCGGGGTTGTCAGGCCCTCCTGGAATAAAAGGAGAGAAGGGTTTCCCCGGATTCCCTGGACTGGACATGCCGGGCCCTAAAGGAGATAAAGGGGCTCAAGGACTCCCTGGCATAACGGGACAGTCGGGGCTCCCTGGCCTTCCTGGACAGCAGGGGGCTCCTGGGATTCCTGGGTTTCCAGGTTCCAAGGGAGAAATGGGCGTCATGGGGACCCCCGGGCAGCCGGGCTCACCAGGACCAGTGGGTGCTCCTGGATTACCGGGTGAAAAAGGGGACCATGGCTTTCCGGGCTCCTCAGGACCCAGGGGAGACCCTGGCTTGAAAGGTGATAAGGGGGATGTCGGTCTCCCTGGCAAGCCTGGCTCCATGGATAAGGTGGACATGGGCAGCATGAAGGGCCAGAAAGGAGACCAAGGAGAGAAAGGACAAATTGGACCAATTGGTGAGAAGGGATCCCGAGGAGACCCTGGGACCCCAGGAGTGCCTGGAAAGGACGGGCAGGCAGGACAGCCTGGGCAGCCAGGACCTAAAGGTGATCCAGGTATAAGTGGAACCCCAGGTGCTCCAGGACTTCCGGGACCAAAAGGATCTGTTGGTGGAATGGGCTTGCCAGGAACACCTGGAGAGAAAGGTGTGCCTGGCATCCCTGGCCCACAAGGTTCACCTGGCTTACCTGGAGACAAAGGTGCAAAAGGAGAGAAAGGGCAGGCAGGCCCACCTGGCATAGGCATCCCAGGGCTGCGAGGTGAAAAGGGAGATCAAGGGATAGCGGGTTTCCCAGGAAGCCCTGGAGAGAAGGGAGAAAAAGGAAGCATTGGGATCCCAGGAATGCCAGGGTCCCCAGGCCTTAAAGGGTCTCCCGGGAGTGTTGGCTATCCAGGAAGTCCTGGGCTACCTGGAGAAAAAGGTGACAAAGGCCTCCCAGGATTGGATGGCATCCCTGGTGTCAAAGGAGAAGCAGGTCTTCCTGGGACTCCTGGCCCCACAGGCCCAGCTGGCCAGAAAGGGGAGCCAGGCAGTGATGGAATCCCGGGGTCAGCAGGAGAGAAGGGTGAACCAGGTCTACCAGGAAGAGGATTCCCAGGGTTTCCAGGGGCCAAAGGAGACAAAGGTTCAAAGGGTGAGGTGGGTTTCCCAGGATTAGCCGGGAGCCCAGGAATTCCTGGATCCAAAGGAGAGCAAGGATTCATGGGTCCTCCGGGGCCCCAGGGACAGCCGGGGTTACCGGGATCCCCAGGCCATGCCACGGAGGGGCCCAAAGGAGACCGCGGACCTCAGGGCCAGCCTGGCCTGCCAGGACTTCCGGGACCCATGGGGCCTCCAGGGCTTCCTGGGATTGATGGAGTTAAAGGTGACAAAGGAAATCCAGGCTGGCCAGGAGCACCCGGTGTCCCAGGGCCCAAGGGAGACCCTGGATTCCAGGGCATGCCTGGTATTGGTGGCTCTCCAGGAATCACAGGCTCTAAGGGTGATATGGGGCCTCCAGGAGTTCCAGGATTTCAAGGTCCAAAAGGTCTTCCTGGCCTCCAGGGAATTAAAGGTGATCAAGGCGATCAAGGCGTCCCGGGAGCTAAAGGTCTCCCGGGTCCTCCTGGCCCCCCAGGTCCTTACGACATCATCAAAGGGGAGCCCGGGCTCCCTGGTCCTGAGGGCCCCCCAGGGCTGAAAGGGCTTCAGGGACTGCCAGGCCCGAAAGGCCAGCAAGGTGTTACAGGATTGGTGGGTATACCTGGACCTCCAGGTATTCCTGGGTTTGACGGTGCCCCTGGCCAGAAAGGAGAGATGGGACCTGCCGGGCCTACTGGTCCAAGAGGATTTCCAGGTCCACCAGGCCCCGATGGGTTGCCAGGATCCATGGGGCCCCCAGGCACCCCATCTGTTGATCACGGCTTCCTTGTGACCAGGCATAGTCAAACAATAGATGACCCACAGTGTCCTTCTGGGACCAAAATTCTTTACCACGGGTACTCTTTGCTCTACGTGCAAGGCAATGAACGGGCCCATGGCCAGGACTTGGGCACGGCCGGCAGCTGCCTGCGCAAGTTCAGCACAATGCCCTTCCTGTTCTGCAATATTAACAACGTGTGCAACTTTGCATCACGAAATGACTACTCGTACTGGCTGTCCACCCCTGAGCCCATGCCCATGTCAATGGCACCCATCACGGGGGAAAACATAAGACCATTTATTAGTAGGTGTGCTGTGTGTGAGGCGCCTGCCATGGTGATGGCCGTGCACAGCCAGACCATTCAGATCCCACCGTGCCCCAGCGGGTGGTCCTCGCTGTGGATCGGCTACTCTTTTGTGATGCACACCAGCGCTGGTGCAGAAGGCTCTGGCCAAGCCCTGGCGTCCCCCGGCTCCTGCCTGGAGGAGTTTAGAAGTGCGCCATTCATCGAGTGTCACGGCCGTGGGACCTGCAATTACTACGCAAACGCTTACAGCTTTTGGCTCGCCACCATAGAGAGGAGCGAGATGTTCAAGAAGCCTACGCCGTCCACCTTGAAGGCAGGGGAGCTGCGCACGCACGTCAGCCGCTGCCAAGTCTGTATGAGAAGAACATAATGAAGCCTGACTCAGCTAATGTCACAACATGGTGCTACTTCTTCTTCTTTTTGTTAACAGCAACGAACCCTAGAAATATATCCTGTGTACCTCACTGTCCAATATGAAAACCGTAAAGTGCCTTATAGGAATTTGCGTAACTAACACACCCTGCTTCATTGACCTCTACTTGCTGAAGGAGAAAAAGACAGCGATAAGCTTTCAATAGTGGCATACCAAATGGCACTTTTGATGAAATAAAATATCAATATTTTCTGCAATCCAATGCACTGATGTGTGAAGTGAGAACTCCATCAGAAAACCAAAGGGTGCTAGGAGGTGTGGGTGCCTTCCATACTGTTTGCCCATTTTCATTCTTGTATTATAATTAATTTTCTACCCCCAGAGATAAATGTTTGTTTATATCACTGTCTAGCTGTTTCAAAATTTAGGTCCCTTGGTCTGTACAAATAATAGCAATGTAAAAATGGTTTTTTGAACCTCCAAATGGAATTACAGACTCAGTAGCCATATCTTCCAACCCCCCAGTATAAATTTCTGTCTTTCTGCTATGTGTGGTACTTTGCAGCTGCTTTTGCAGAAATCACAATTTTCCTGTGGAATAAAGATGGTCCAAAAATAGTCAAAAATTAAATATATATATATATTAGTAATTTATATAGATGTCAGCAATTAGGCAGATCAAGGTTTAGTTTAACTTCCACTGTTAAAATAAAGCTTACATAGTTTTCTTCCTTTGAAAGACTGTGCTGTCCTTTAACATAGGTTTTTAAAGACTAGGATATTGAATGTGAAACATCCGTTTTCATTGTTCACTTCTAAACCAAAAATTATGTGTTGCCAAAACCAAACCCAGGTTCATGAATATGGTGTCTATTATAGTGAAACATGTACTTTGAGCTTATTGTTTTTATTCTGTATTAAATATTTTCAGGGTTTTAAACACTAATCACAAACTGAATGACTTGACTTCAAAAGCAACAACCTTAAAGGCCGTCATTTCATTAGTATTCCTCATTCTGCATCCTGGCTTGAAAAACAGCTCTGTTGAATCACAGTATCAGTATTTTCACACGTAAGCACATTCGGGCCATTTCCGTGGTTTCTCATGAGCTGTGTTCACAGACCTCAGCAGGGCATCGCATGGACCGCAGGAGGGCAGATTCGGACCACTAGGCCTGAAATGACATTTCACTAAAAGTCTCCAAAACATTTCTAAGACTACTAAGGCCTTTTATGTAATTTCTTTAAATGTGTATTTCTTAAGAATTCAAATTTGTAATAAAACTATTTGTATAAAAATTAAGCTTTTATTAATTTGTTGCTAGTATTGCCACAGACGCATTAAAAGAAACTTACTGCACAAGCTGCTAATAAATTTGTAAGCTTTGCATACCTTA