Transcript asmbl_37841

Sequence
Transcript Sequence for observation asmbl_37841 of TGE0000335:
CGCTGTTCCGTGGTCCGCGCGAGCGTGGTCGGGAGCCGCTGGTTCCTGGGGTGACCCGCGGAGGTGGGAGAGGGAAGGGCTTCCGAAGCCGGCGGGGGTGCCATGGACCCTCTCCGCCGGCGCGGCCTTCACAGCTGGGCCGCGCCGGGCATCCGTAGTCCGCTCTCCCAAAGCCTCGGTGGAGCTGAAGCTGCCACAGAGTGCATGTTCACAAAGGGTCATCACACACGGAGCTGCCCCTCCCTGTCTCCCTAGAGCCCATCTTCGAGGCCAGGGGCTTTTCTACCAGGATTCTGGGGTGTTTCTCCTCCTTTCCTCCCTCCCAGATCTTCTCACGAAAAATAACTAAACATGGGCAAAGGAGATCCTAAGAAGCCGAGAGGCAAAATGTCATCATATGCATTTTTTGTGCAAACTTGTCGGGAGGAGCATAAGAAGAAGCACCCAGATGCTTCAGTCAACTTCTCAGAGTTTTCTAAGAAGTGCTCAGAGAGGTGGAAGACCATGTCTGCTAAAGAGAAAGGAAAATTTGAAGATATGGCAAAAGCGGACAAGGCCCGTTATGAAAGAGAAATGAAAACCTATATCCCTCCCAAAGGGGAGACAAAAAAGAAGTTCAAGGATCCCAATGCACCCAAGAGGCCTCCTTCGGCCTTCTTCCTCTTCTGCTCTGAGTATCGCCCAAAAATCAAAGGAGAACATCCTGGCCTGTCCATTGGTGATGTTGCGAAGAAACTGGGAGAGATGTGGAATAACACTGCTGCAGATGACAAGCAGCCTTATGAAAAGAAGGCTGCGAAGCTGAAGGAAAAATATGAAAAGGATATTGCTGCATATCGAGCTAAAGGAAAGCCTGATGCAGCAAAAAAGGGAGTTGTCAAGGCTGAAAAAAGCAAGAAAAAGAAGGAAGAGGAGGAAGATGAGGAAGATGAAGAGGATGAGGAGGAGGAGGAAGATGAAGAAGATGAAGATGAAGAAGAAGATGATGATGATGAATAAGTTGGTTCTAGCGCAGTTTTTTTTTTCTTGTCTATAAAGCATTTAACCCCCCTGTACACAACTCACTCCTTTTAAAGAAAAAAATTGAAATGTAAGGCTGTGTAAGATTTGTTTTTAAACTGTACAGTGTCTTTTTTTGTATAGTTAACACACTACCGAATGTGTCTTTAGATAGCCCTGTCCTGGTGGTAT