Transcript asmbl_37765

Sequence
Transcript Sequence for observation asmbl_37765 of TGE0057225:
CTTTGGCGGAGGGGTGGGACTTGCACCGGCGTCTCTTCTTCTAACTGCAGTTTGTGGCAGCGCCATTTTGAATGTGCAGCTGCAGCGGGCGTGAGTTGGGGGAGGACGGGTTGCCGACTCGCCTACCTAGCGGTCTCTTGATTGTCGATATTTTGTTGGCATAGGTTTATGTAGAGACGTATACATATATATAGACACACTGTCTATAAATCTAGGCCTGTATCCGGTGTCCGAGGCGAACTCAGTAAGATGATGTTAAGAGGAAACCTGAAGCAAGTGCGCATTGAGAAAAACCCGGCCCGCCTTCGCGCCCTGGAGTCCGCGGTGGGCGAGAGCGAGCCGGCGGCCGCGGCAGCCATGGCGCTCGCTCTTGCCGGGGAGCCGGCACCGCCCGCGCCCGCGCCTCCAGAGGACCACCCGGACGAGGAGATGGGGTTCACTATCGACATCAAGAGTTTCCTCAAGCCGGGCGAGAAGACGTACACGCAGCGCTGCCGCCTCTTCGTGGGAAATCTGCCCACCGACATCACGGAGGAGGACTTCAAGAGGCTCTTCGAACGCTATGGCGAGCCCAGCGAAGTCTTCATCAACCGGGACCGTGGCTTCGGCTTCATCCGCTTGGAATCCAGAACCCTGGCTGAAATTGCAAAAGCAGAGCTGGACGGCACCATTCTCAAGAGCAGACCTCTACGGATTCGCTTCGCTACACATGGAGCAGCCTTGACTGTCAAGAACCTTTCTCCAGTTGTTTCCAATGAGCTGCTAGAGCAAGCATTTTCTCAGTTTGGTCCAGTAGAGAAAGCTGTTGTGGTTGTGGATGATCGCGGTAGAGCTACAGGAAAAGGTTTTGTAGAGTTTGCAGCAAAACCTCCTGCACGAAAGGCTCTGGAAAGATGTGGTGATGGGGCATTCTTGCTAACAACGACCCCTCGTCCAGTCATTGTGGAACCCATGGAGCAGTTTGATGATGAAGATGGCTTGCCAGAGAAGCTGATGCAGAAAACTCAACAATATCATAAGGAAAGAGAACAACCACCACGTTTTGCTCAACCTGGGACATTTGAATTTGAGTATGCATCTCGATGGAAGGCTCTTGATGAAATGGAAAAGCAGCAGCGTGAGCAGGTTGATAGAAACATCAGAGAAGCCAAAGAGAAACTGGAGGCAGAAATGGAAGCAGCTAGGCATGAACACCAATTAATGCTAATGAGGCAAGATCTAATGAGGCGTCAAGAAGAACTCAGACGCTTGGAAGAACTCAGAAACCAAGAGTTGCAAAAACGGAAGCAAATACAACTAAGACATGAAGAGGAGCATCGGCGGCGTGAGGAAGAAATGATCCGACACAGAGAACAGGAGGAACTGAGGCGACAGCAAGAGGGCTTTAAGCCAAACTACATGGAAAATGGTGATAAAAGAAAATGTGGCTGAAGTTACCCGAAGTTCAGCTTGCAGTGTAATTCAGAAGAGTTAAGACCAGAAGTACTGGAATCATACTTCCTTTCAGGTCAGTCCGTATCTGCTCATTATTTTCTAACAGATCCTTGAGTATTCGTTTCTTCCTAGTTTTTTCTAGTCAATTCTTCCTGATTCTGATTCTGTGG