Transcript asmbl_37764

Sequence
Transcript Sequence for observation asmbl_37764 of TGE0057225:
CTTTGGCGGAGGGGTGGGACTTGCACCGGCGTCTCTTCTTCTAACTGCAGTTTGTGGCAGCGCCATTTTGAATGTGCAGCTGCAGCGGGCGTGAGTTGGGGGAGGACGGGTTGCCGACTCGCCTACCTAGCGGTCTCTTGATTGTCGATATTTTGTTGGCATAGGTTTATGTAGAGACGTATACATATATATAGACACACTGTCTATAAATCTAGGCCTGTATCCGGTGTCCGAGGCGAACTCAGTAAGATGATGTTAAGAGGAAACCTGAAGCAAGTGCGCATTGAGAAAAACCCGGCCCGCCTTCGCGCCCTGGAGTCCGCGGTGGGCGAGAGCGAGCCGGCGGCCGCGGCAGCCATGGCGCTCGCTCTTGCCGGGGAGCCGGCACCGCCCGCGCCCGCGCCTCCAGAGGACCACCCGGACGAGGAGATGGGGTTCACTATCGACATCAAGAGTTTCCTCAAGCCGGGCGAGAAGACGTACACGCAGCGCTGCCGCCTCTTCGTGGGAAATCTGCCCACCGACATCACGGAGGAGGACTTCAAGAGGCTCTTCGAACGCTATGGCGAGCCCAGCGAAGTCTTCATCAACCGGGACCGTGGCTTCGGCTTCATCCGCTTGGAATCCAGAACCCTGGCTGAAATTGCAAAAGCAGAGCTGGACGGCACCATTCTCAAGAGCAGACCTCTACGGATTCGCTTCGCTACACATGGAGCAGCCTTGACTGTCAAGAACCTTTCTCCAGTTGTTTCCAATGAGCTGCTAGAGCAAGCATTTTCTCAGTTTGGTCCAGTAGAGAAAGCTGTTGTGGTTGTGGATGATCGCGGTAGAGCTACAGGAAAAGGTTTTGTAGAGTTTGCAGCAAAACCTCCTGCACGAAAGGCTCTGGAAAGATGTGGTGATGGGGCATTCTTGCTAACAACGACCCCTCGTCCAGTCATTGTGGAACCCATGGAGCAGTTTGATGATGAAGATGGCTTGCCAGAGAAGCTGATGCAGAAAACTCAACAATATCATAAGGAAAGAGAACAACCACCACGTTTTGCTCAACCTGGGACATTTGAATTTGAGTATGCATCTCGATGGAAGGCTCTTGATGAAATGGAAAAGCAGCAGCGTGAGCAGGTTGATAGAAACATCAGAGAAGCCAAAGAGAAACTGGAGGCAGAAATGGAAGCAGCTAGGCATGAACACCAATTAATGCTAATGAGGCAAGATCTAATGAGGCGTCAAGAAGAACTCAGACGCTTGGAAGAACTCAGAAACCAAGAGTTGCAAAAACGGAAGCAAATACAACTAAGACATGAAGAGGAGCATCGGCGGCGTGAGGAAGAAATGATCCGACACAGAGAACAGGAGGAACTGAGGCGACAGCAAGAGGGCTTTAAGCCAAACTACATGGAAAATGGTGATAAAAGAAAATGTGGCTGAAGTTACCCGAAGTTCAGCTTGCAGTGTAATTCAGAAGAGTTAAGACCAGAAGTACTGGAATCATACTTCCTTTCAGTCTTGCCACTTGCCTAGTGAGGCTTTTCCGAACCTGGAAGGAGACGTCTAGAAATCCCAACTTTGCTGTGTAAGGACCATTAGCTGCAAGTCAGTGGAAGTCTATAGAAAGCAGTGTGAATTCCATAGTGGTCTTGACTTCTTAGCAAGGATTTGGGATAAGTCTAAAACTTCAGACTTAAAGCTTTGAAGCATGTTAACTGCATGAAATATTAAACATTTCGAACTTCTTTAGCCTTTGTCATTTTGTGACCCAGGTTTTTCATAGTCTGCTCTATGTCTCCTGCTTTTCCTTGTTTTGCTAATCATCCTCCTTGAGCTCCACTGTTTTCATTCTGGGCATCCAATCCAGCCTTTCAT