Transcript asmbl_37763

Sequence
Transcript Sequence for observation asmbl_37763 of TGE0057225:
CTTTGGCGGAGGGGTGGGACTTGCACCGGCGTCTCTTCTTCTAACTGCAGTTTGTGGCAGCGCCATTTTGAATGTGCAGCTGCAGCGGGCGTGAGTTGGGGGAGGACGGGTTGCCGACTCGCCTACCTAGCGGTCTCTTGATTGTCGATATTTTGTTGGCATAGGTTTATGTAGAGACGTATACATATATATAGACACACTGTCTATAAATCTAGGCCTGTATCCGGTGTCCGAGGCGAACTCAGTAAGATGATGTTAAGAGGAAACCTGAAGCAAGTGCGCATTGAGAAAAACCCGGCCCGCCTTCGCGCCCTGGAGTCCGCGGTGGGCGAGAGCGAGCCGGCGGCCGCGGCAGCCATGGCGCTCGCTCTTGCCGGGGAGCCGGCACCGCCCGCGCCCGCGCCTCCAGAGGACCACCCGGACGAGGAGATGGGGTTCACTATCGACATCAAGAGTTTCCTCAAGCCGGGCGAGAAGACGTACACGCAGCGCTGCCGCCTCTTCGTGGGAAATCTGCCCACCGACATCACGGAGGAGGACTTCAAGAGGCTCTTCGAACGCTATGGCGAGCCCAGCGAAGTCTTCATCAACCGGGACCGTGGCTTCGGCTTCATCCGCTTGGAATCCAGAACCCTGGCTGAAATTGCAAAAGCAGAGCTGGACGGCACCATTCTCAAGAGCAGACCTCTACGGATTCGCTTCGCTACACATGGAGCAGCCTTGACTGTCAAGAACCTTTCTCCAGTTGTTTCCAATGAGCTGCTAGAGCAAGCATTTTCTCAGTTTGGTCCAGTAGAGAAAGCTGTTGTGGTTGTGGATGATCGCGGTAGAGCTACAGGAAAAGGTTTTGTAGAGTTTGCAGCAAAACCTCCTGCACGAAAGGCTCTGGAAAGATGTGGTGATGGGGCATTCTTGCTAACAACGACCCCTCGTCCAGTCATTGTGGAACCCATGGAGCAGTTTGATGATGAAGATGGCTTGCCAGAGAAGCTGATGCAGAAAACTCAACAATATCATAAGGAAAGAGAACAACCACCACGTTTTGCTCAACCTGGGACATTTGAATTTGAGTATGCATCTCGATGGAAGGCTCTTGATGAAATGGAAAAGCAGCAGCGTGAGCAGGTTGATAGAAACATCAGAGAAGCCAAAGAGAAACTGGAGGCAGAAATGGAAGCAGCTAGGCATGAACACCAATTAATGCTAATGAGGCAAGATCTAATGAGGCGTCAAGAAGAACTCAGACGCTTGGAAGAACTCAGAAACCAAGAGTTGCAAAAACGGAAGCAAATACAACTAAGACATGAAGAGGAGCATCGGCGGCGTGAGGAAGAAATGATCCGACACAGAGAACAGGAGGAACTGAGGCGACAGCAAGAGGGCTTTAAGCCAAACTACATGGAAAATGGTGATAAAAGAAAATGTGGCTGAAGTTACCCGAAGTTCAGCTTGCAGTGTAATTCAGAAGAGTTAAGACCAGAAGTACTGGAATCATACTTCCTTTCAGGTCAAAACATTTTGTGGGAAATATCCTGTTCGTGACCTAGGAGAAACAAGACAGAAAACAAATCTTTCTTCATTTATGAATTTCTTACTCCATACAAGCAGTTTATGGATGTCTGGGCAATCATAGCACTTGCCATTTAAAAACATGCTACAGGGGCACATTTTCTGTGGTTAAAAATGATCTCCAGAATAAGTGTAAACTGCAGTTTTCCTTTGCATTGAGGGTTTTGGCTTTTTATTTGTAAATTAAATCAAGATGTTACCCACTCCTTGGTGTGGTGGTCTTGCTGGTTCGTGTTGGGAAGTAGTATGGCAGCAATGCACAAATTCAGAATAGCCAAGAAATCCCTCCTTTTCAACGCTCTGTGCCTGGGAACCATTAGAGGAGTTTTAAAAACCATCCCTCATAGCCCACAATTTTGGGTCAACTCTCAAAATTGGGAATAAGAAAACTGGCACTGTTGGGAGAAAAATCGTTCTTACTGAAACATGAACTGGCTCAGGCAAGCAAATAGCGGGAGTCGGCACAGGAAGGAGTGTGTGCTGCGGGGATGCGTGGTGGCGTCACCTTCAAAACTAAAGTGGTGCCAGGCGGACAGATGAGTCCTTGATCTTGTTTCCTGATCTTGTTTCCATTTGACTGAATTCTGAACCTTCATTGTCTTCACAGTCTTGCCACTTGCCTAGTGAGGCTTTTCCGAACCTGGAAGGAGACGTCTAGAAATCCCAACTTTGCTGTGTAAGGACCATTAGCTGCAAGTCAGTGGAAGTCTATAGAAAGCAGTGTGAATTCCATAGTGGTCTTGACTTCTTAGCAAGGATTTGGGATAAGTCTAAAACTTCAGACTTAAAGCTTTGAAGCATGTTAACTGCATGAAATATTAAACATTTCGAACTTCTTTAGCCTTTGTCATTTTGTGACCCAGGTTTTTCATAGTCTGCTCTATGTCTCCTGCTTTTCCTTGTTTTGCTAATCATCCTCCTTGAGCTCCACTGTTTTCATTCTGGGCATCCAATCCAGCCTTTCAT