Transcript asmbl_37022

Sequence
Transcript Sequence for observation asmbl_37022 of TGE0056198:
GCTCAGTGGCCCTGAGACCCTAGCTCTGCTCTCGGTCCGCTCGCTGTCCGCTAGCCCGCTGCGATGTTGCGCGCTGCCGCCCGCTTCGGGCCCCGCCTGGGCCGCCGCCTCTTGTCAGCCGCCGCCACCCAGGCCGTGCCTGCCCCCAACCAGCAGCCCGAGGTCTTCTGCAACCAGATTTTCATAAACAATGAATGGCACGATGCCGTCAGCAGGAAAACATTCCCCACCGTCAATCCGTCCACTGGAGAGGTCATCTGTCAGGTAGCTGAAGGGGACAAGGAAGATGTGGACAAGGCAGTGAAGGCCGCCCGGGCCGCCTTCCAGCTGGGCTCACCTTGGCGCCGCATGGACGCATCACACAGGGGCCGGCTGCTGAACCGCCTGGCCGATCTGATCGAGCGGGACCGGACCTACCTGGCGGCCTTGGAGACCCTGGACAATGGCAAGCCCTATGTCATCTCCTACCTGGTGGATTTGGACATGGTCCTCAAATGTCTCCGGTATTATGCCGGCTGGGCTGATAAGTACCACGGGAAAACCATCCCCATTGACGGAGACTTCTTCAGCTACACACGCCATGAACCTGTGGGGGTGTGCGGGCAGATCATTCCGTGGAATTTCCCGCTCCTGATGCAAGCATGGAAGCTGGGCCCAGCCTTGGCAACTGGAAACGTGGTTGTGATGAAGGTAGCTGAGCAGACACCCCTCACCGCCCTCTATGTGGCCAACCTGATCAAGGAGGCTGGCTTTCCCCCTGGTGTGGTCAACATTGTGCCTGGATTTGGCCCCACGGCTGGGGCCGCCATTGCCTCCCATGAGGATGTGGACAAAGTGGCATTCACAGGCTCCACTGAGATTGGCCGCGTAATCCAGGTTGCTGCTGGGAGCAGCAACCTCAAGAGAGTGACCTTGGAGCTGGGGGGGAAGAGCCCCAACATCATCATGTCAGATGCCGATATGGATTGGGCCGTGGAACAGGCCCACTTCGCCCTGTTCTTCAACCAGGGCCAGTGCTGCTGTGCCGGCTCCCGGACCTTCGTGCAGGAGGACATCTATGATGAGTTTGTGGAGCGGAGCGTTGCCCGGGCCAAGTCTCGGGTGGTCGGGAACCCCTTTGATAGCAAGACCGAGCAGGGGCCGCAGGTGGATGAAACTCAGTTTAAGAAGATCCTCGGCTACATCAACACGGGGAAGCAAGAGGGGGCGAAGCTGCTGTGTGGTGGGGGCATTGCTGCTGACCGTGGTTACTTCATCCAGCCCACTGTGTTTGGAGATGTGCAGGATGGCATGACCATCGCCAAGGAGGAGATCTTCGGGCCAGTGATGCAGATCCTGAAGTTCAAGACCATAGAGGAGGTTGTTGGGAGAGCCAACAATTCCACGTACGGGCTGGCCGCAGCTGTCTTCACAAAGGATTTGGACAAGGCCAATTACCTGTCCCAGGCCCTCCAGGCGGGCACTGTGTGGGTCAACTGCTATGATGTGTTTGGAGCCCAGTCACCCTTTGGTGGCTACAAGATGTCGGGGAGTGGCCGGGAGTTGGGCGAGTACGGGCTGCAGGCATACACTGAAGTGAAAACTGTCACAGTCAAAGTGCCTCAGAAGAACTCATAAGAATCATGCAAGCTTCCTCCCTCAGCCATTGATGGAAAGTTCAGCAAGATCAGCAACAAAACCAAGAAAAATGATCCTTGCGTGCTGAATATCTGAAAAGAGAAATTTTTCCTACAAAATCTCTTGGGTCAAGAAAGTTCTAGAATTTGAATTGATAAACATGGTGGGTTGGCTGAGGGTAAGAGTATATGAGGAACCTTTTAAACGACAACAATACTGCTAGCTTTCAGGATGATTTTTAAAAAATAGATTCAAATGTGTTATCCTCTCTCTGAAACGCTTCCTATAACTCGAGTTTATAGGGGAAGAAAAAGCTATTGTTTACAATTATATCACCATTAAGGCAACTGCTACACCCTGCTTTGTATTCTGGGCTAAGATTCATTAAAAACTAGCTGCTCTTAAC