Transcript asmbl_36998

Sequence
Transcript Sequence for observation asmbl_36998 of TGE0059624:
GGGAGGCAGCGGCCGATAAATGCTATTAGAGCAGCCGCCGCGGAGCCGTCCCCGACGCCACCTCCTTTTCCTTCGCCGCAGTTTCCTCCGCCGCTGTCGGGCGTGCGGCGCTGAGGGACCCGGGCGAGCGCGCCGCGCACCGCCCCGCCGGCTCGCCTCCCTCGCCGCGTTCCGCCCTCAGTGGTCTGCCGGGCGCCCCCTCCTCCGGCCCGGGCGGGGCCTCTGATCGCCTCAAGAGAGCGGGGAGGGGGCTCGGGGGCCGCGGCCTGCCCTCCCGGCGGGCGGCTGAGGGCGAGGGAGGCCCTCCCTTCTGGCGAGGGGAGGGAGGGTGGGTCAGGAGCCCCCAACCCGCCCTGCGGAGCTCGGGGCCGCGCGAGGGGCGGTTGTCTGGGGGAGGGGGCGCGGGGTGATTCAGCGCCCGGCGAGGCGGAAGCGGCCGCAAGAGGAGGAGGGGAGAGCCCGTCCGCGCCTGGGCTCCCGGGGTGGCACGAGCCCGCGGCCGGAGTGCGAGGCGGAGGCGAGGAGGCCGCGGGGACGGGAGGCGAGGCCGGCCGGGCCCCCGAAGCCATGGAGAACGCGCACACCAAGACGGTGGAGGAGGTGCTGGGCCACTTCGGCGTCAACGAGAGTACGGGGCTGAGCCTGGAACAGGTCAAGAAGCTTAAGGAGAGATGGGGCTCCAACGAGTTACCGGCTGAAGAAGGAAAAACCTTGCTGGAACTTGTGATTGAGCAGTTTGAAGACTTGCTAGTTAGGATTTTATTACTGGCAGCATGTATATCTTTTGTTTTGGCTTGGTTTGAAGAAGGTGAAGAAACAATTACAGCCTTTGTAGAACCTTTTGTAATTTTACTCATATTAGTAGCCAATGCAATTGTGGGTGTATGGCAGGAAAGAAATGCTGAAAATGCCATCGAAGCCCTTAAGGAATATGAGCCTGAAATGGGCAAAGTGTATCGACAGGACAGAAAGAGTGTGCAGCGGATTAAAGCTAAAGACATAGTTCCTGGTGATATTGTAGAAATTGCTGTTGGTGACAAAGTTCCTGCTGATATAAGGTTAACTTCCATCAAATCTACCACACTAAGAGTTGACCAGTCAATTCTCACAGGTGAATCTGTCTCTGTCATCAAGCACACTGATCCCGTCCCTGACCCACGAGCTGTCAACCAAGATAAAAAGAACATGCTGTTTTCTGGTACAAACATTGCTGCTGGGAAAGCTATGGGAGTGGTGGTAGCAACTGGAGTTAACACCGAAATTGGCAAGATCCGGGATGAAATGGTGGCAACAGAACAGGAGAGAACACCCCTTCAGCAAAAACTAGATGAATTTGGGGAACAGCTTTCCAAAGTCATCTCCCTTATTTGCATTGCAGTCTGGATCATAAATATTGGGCACTTCAATGACCCGGTTCATGGAGGGTCCTGGATCAGAGGTGCTATTTACTACTTTAAAATTGCAGTGGCCCTGGCTGTAGCAGCCATTCCTGAAGGTCTGCCTGCAGTCATCACCACCTGCCTGGCTCTTGGAACTCGCAGAATGGCAAAGAAAAATGCCATTGTTCGAAGCCTCCCGTCTGTGGAAACCCTTGGTTGTACTTCTGTTATCTGCTCAGACAAGACTGGTACACTTACAACAAACCAGATGTCAGTCTGCAGGATGTTCATTCTGGACAGAGTGGAAGGTGATACTTGTTCCCTTAATGAGTTTACCATAACTGGATCAACTTATGCACCTATTGGAGAAGTGCATAAAGATGATAAACCAGTGAATTGTCACCAGTATGATGGTCTGGTAGAATTAGCAACAATTTGTGCTCTTTGTAATGACTCTGCTTTGGATTACAATGAGGCAAAGGGTGTGTATGAAAAAGTTGGAGAAGCTACAGAGACTGCTCTCACTTGCCTAGTAGAGAAGATGAATGTATTTGATACCGAATT