Transcript asmbl_36910

Sequence
Transcript Sequence for observation asmbl_36910 of TGE0059621:
CGACCTGCTTGCGGTGTAGTGGGCGGACCGCGCGGCTGGAGGTGTGAGGATCCGAACCCAGGGGTGGGGGGTGGAGGCGGCTCCTGCGATCGAAGGGGACTTGAGACTCACCGGCCGCACGCCATGAGGGCCCTGTGGGTGCTGGGCCTCTGCTGCGTCCTGCTGACCTTCGGGTCGGTCAGAGCTGACGATGAAGTTGATGTGGATGGTACAGTAGAAGAGGATCTGGGTAAAAGTAGAGAAGGATCAAGGACGGATGATGAAGTAGTACAGAGAGAGGAAGAAGCTATTCAGTTGGATGGATTAAATGCATCACAAATAAGAGAACTTAGAGAGAAGTCGGAAAAGTTTGCCTTCCAAGCCGAAGTTAACAGAATGATGAAACTTATCATCAATTCATTGTATAAAAATAAAGAGATTTTCCTGAGAGAACTGATTTCAAATGCTTCTGATGCTTTAGATAAGATAAGGCTAATATCACTGACTGATGAAAATGCTCTTTCTGGAAATGAGGAACTAACAGTCAAAATTAAGTGTGATAAGGAGAAGAACCTGCTGCATGTCACAGACACCGGTGTAGGAATGACCAGAGAAGAGTTGGTTAAAAACCTTGGTACCATAGCCAAATCTGGGACAAGCGAGTTTTTAAACAAAATGACTGAAGCACAGGAAGATGGCCAGTCAACTTCTGAATTGATTGGCCAGTTTGGTGTCGGTTTCTATTCCGCCTTCCTTGTAGCAGATAAGGTTATTGTCACTTCAAAACACAACAACGATACCCAGCACATCTGGGAGTCTGACTCCAATGAATTTTCTGTAATTGCTGACCCAAGAGGAAACACTCTAGGACGGGGAACGACAATTACCCTTGTCTTAAAAGAAGAAGCATCTGATTACCTTGAATTGGATACAATTAAAAATCTCGTCAAAAAATATTCACAGTTCATAAACTTTCCTATTTATGTATGGAGCAGCAAGACTGAAACTGTTGAGGAGCCCATGGAGGAAGAAGAAGCAGCCAAAGAAGAGAAAGAAGAATCTGATGATGAAGCTGCAGTAGAGGAAGAAGAAGAAGAAAAGAAACCAAAGACTAAAAAAGTTGAAAAAACTGTCTGGGACTGGGAACTTATGAATGATATCAAACCAATATGGCAGAGACCATCAAAAGAAGTAGAAGAAGATGAATACAAAGCTTTCTACAAATCATTTTCAAAGGAAAGTGATGACCCCATGGCTTATATTCACTTTACTGCTGAAGGGGAAGTTACCTTCAAATCAATTTTATTTGTACCCACATCTGCTCCACGTGGTCTGTTTGACGAATATGGATCTAAAAAGAGCGATTACATTAAGCTCTATGTGCGCCGTGTATTCATCACAGACGACTTCCATGATATGATGCCTAAATACCTCAATTTTGTCAAGGGTGTGGTGGACTCAGATGATCTCCCCTTGAATGTTTCCCGCGAGACTCTTCAGCAACATAAACTGCTTAAGGTGATTAGGAAGAAGCTTGTTCGTAAAACGCTGGACATGATCAAGAAGATTGCTGATGATAAATACAATGATACTTTTTGGAAAGAATTTGGTACCAACATCAAGCTTGGTGTGATTGAAGACCACTCGAATCGAACACGTCTTGCTAAACTTCTTAGGTTCCAGTCTTCTCATCATCCAACTGACATTACTAGCCTAGACCAGTATGTGGAAAGAATGAAGGAAAAACAAGACAAAATCTACTTCATGGCTGGGTCCAGCAGAAAAGAGGCTGAATCTTCTCCATTTGTTGAGCGACTTCTGAAAAAGGGCTATGAAGTTATTTACCTCACAGAACCTGTGGATGAATACTGTATTCAGGCCCTTCCCGAATTTGATGGGAAGAGGTTCCAGAATGTTGCCAAGGAAGGAGTGAAGTTCGATGAAAGTGAGAAAACTAAGGAGAGTCGTGAAGCAGTTGAGAAAGAATTTGAGCCTCTGCTGAATTGGATGAAAGATAAAGCCCTTAAGGACAAGATTGAAAAGGCTGTGGTGTCTCAGCGCCTGACAGAATCTCCGTGTGCTTTGGTGGCCAGCCAGTACGGATGGTCTGGCAACATGGAGAGAATCATGAAAGCACAAGCGTACCAAACGGGCAAGGACATCTCTACAAATTACTATGCGAGTCAGAAGAAAACATTTGAAATTAATCCCAGACACCCGCTGATCAGAGACATGCTTCGACGAATTAAGGAAGATGAAGATGATAAAACAGTTTTGGATCTTGCTGTGGTTTTGTTTGAAACAGCAACGCTTCGGTCAGGGTATCTTTTACCAGACACTAAAGCATATGGAGATAGAATAGAAAGAATGCTTCGCCTCAGTTTGAACATTGACCCTGATGCAAAGGTGGAAGAAGAGCCCGAAGAAGAACCTGAAGAGACAGCAGAAGACACAACAGAAGACACAGAGCAAGACGAAGATGAAGAAATGGATGTGGGAACAGATGAAGAAGAAGAAACAGCAAAGGAATCTACAGCTGAAAAAGATGAATTGTAAATTATACTCTCACCATTTGGATCCTGTGTGGAGAGGGAATGTGAAATTTACATCATTTCTTTTTGGGAGAGACTTGTTTTGGATGCCCCCTAATCCCCTTCTCCCCTGCACTGTAAAATGTGGGATTATGGGTCACAGGAAAAAGTGGGTTTTTTAGTTGAATTTTTTTTAACATTCCTCATGAATGTAAATTTGTACTATTTAACTGACTATTCTTGATGTAAAATCTTGTCATGTGTATAAAAATAAAAAAGATCCCAAATACTCAGTGTCTTGACTGTCTTGCAGAGAACTACCTAATACTTGGC