Transcript asmbl_36909

Sequence
Transcript Sequence for observation asmbl_36909 of TGE0059620:
CGACCTGCTTGCGGTGTAGTGGGCGGACCGCGCGGCTGGAGGTGTGAGGATCCGAACCCAGGGGTGGGGGGTGGAGGCGGCTCCTGCGATCGAAGGGGACTTGAGACTCACCGGCCGCACGCCATGAGGGCCCTGTGGGTGCTGGGCCTCTGCTGCGTCCTGCTGACCTTCGGGTCGGTCAGAGCTGACGATGAAGTTGATGTGGATGGTACAGTAGAAGAGGATCTGGGTAAAAGTAGAGAAGGATCAAGGACGGATGATGAAGTAGTACAGAGAGAGGAAGAAGCTATTCAGTTGGATGGATTAAATGCATCACAAATAAGAGAACTTAGAGAGAAGTCGGAAAAGTTTGCCTTCCAAGCCGAAGTTAACAGAATGATGAAACTTATCATCAATTCATTGTATAAAAATAAAGAGATTTTCCTGAGAGAACTGATTTCAAATGCTTCTGATGCTTTAGATAAGATAAGGCTAATATCACTGACTGATGAAAATGCTCTTTCTGGAAATGAGGAACTAACAGTCAAAATTAAGTGTGATAAGGAGAAGAACCTGCTGCATGTCACAGACACCGGTGTAGGAATGACCAGAGAAGAGTTGGTTAAAAACCTTGGTACCATAGCCAAATCTGGGACAAGCGAGTTTTTAAACAAAATGACTGAAGCACAGGAAGATGGCCAGTCAACTTCTGAATTGATTGGCCAGTTTGGTGTCGGTTTCTATTCCGCCTTCCTTGTAGCAGATAAGGTTATTGTCACTTCAAAACACAACAACGATACCCAGCACATCTGGGAGTCTGACTCCAATGAATTTTCTGTAATTGCTGACCCAAGAGGAAACACTCTAGGACGGGGAACGACAATTACCCTTGTCTTAAAAGAAGAAGCATCTGATTACCTTGAATTGGATACAATTAAAAATCTCGTCAAAAAATATTCACAGTTCATAAACTTTCCTATTTATGTATGGAGCAGCAAGACTGAAACTGTTGAGGAGCCCATGGAGGAAGAAGAAGCAGCCAAAGAAGAGAAAGAAGAATCTGATGATGAAGCTGCAGTAGAGGAAGAAGAAGAAGAAAAGAAACCAAAGACTAAAAAAGTTGAAAAAACTGTCTGGGACTGGGAACTTATGAATGATATCAAACCAATATGGCAGAGACCATCAAAAGAAGTAGAAGAAGATGAATACAAAGCTTTCTACAAATCATTTTCAAAGGAAAGTGATGACCCCATGGCTTATATTCACTTTACTGCTGAAGGGGAAGTTACCTTCAAATCAATTTTATTTGTACCCACATCTGCTCCACGTGGTCTGTTTGACGAATATGGATCTAAAAAGAGCGATTACATTAAGCTCTATGTGCGCCGTGTATTCATCACAGACGACTTCCATGATATGATGCCTAAATACCTCAATTTTGTCAAGGGTGTGGTGGACTCAGATGATCTCCCCTTGAATGTTTCCCGCGAGACTCTTCAGCAACATAAACTGCTTAAGGTGATTAGGAAGAAGCTTGTTCGTAAAACGCTGGACATGATCAAGAAGATTGCTGATGATAAATACAATGATACTTTTTGGAAAGAATTTGGTACCAACATCAAGCTTGGTGTGATTGAAGACCACTCGAATCGAACACGTCTTGCTAAACTTCTTAGGTTCCAGTCTTCTCATCATCCAACTGACATTACTAGCCTAGACCAGTATGTGGAAAGAATGAAGGAAAAACAAGACAAAATCTACTTCATGGCTGGGTCCAGCAGAAAAGAGGCTGAATCTTCTCCATTTGTTGAGCGACTTCTGAAAAAGGGCTATGAAGTTATTTACCTCACAGAACCTGTGGATGAATACTGTATTCAGGCCCTTCCCGAATTTGATGGGAAGAGGTTCCAGAATGTTGCCAAGGAAGGAGTGAAGTTCGATGAAAGTGAGAAAACTAAGGAGAGTCGTGAAGCAGTTGAGAAAGAATTTGAGCCTCTGCTGAATTGGATGAAAGATAAAGCCCTTAAGGACAAGGTGGTATTTAAACTTCTGACTAGAAAATTCAGATTATCAAATTGAAAAGGCTGTGGTGTCTCA