Transcript asmbl_36459

Sequence
Transcript Sequence for observation asmbl_36459 of TGE0000248:
GGAGTGTCCCCGAGGTCAGCGAGTGCGCGCTCCTCCTCGCCCGCCGCTAGGTCCATCCCGGCCCAGCCACCATGTCCATCCACTTCAGCTCCCCGGTATTCACCTCGCGCTCAGCCGCCTTCTCGGGCCGCGGCGCCCAGGTGCGCCTGAGCTCCGCTCGCCCCGGCGGCCTTGGCAGCAGCAGCCTCTACGGCCTCGGCGCCTCACGGCCGCGCGTGGCCGTGCGCTCTGCCTATGGGGGCCCGGTGGGCGCCGGCATCCGCGAGGTCACCATTAACCAGAGCCTGCTGGCCCCGCTGCGGCTGGACGCCGACCCCTCCCTCCAGCGGGTGCGCCAGGAGGAGAGCGAGCAGATCAAGACCCTCAACAACAAGTTTGCCTCCTTCATCGACAAGGTGCGGTTTCTGGAGCAGCAGAACAAGCTGCTGGAGACCAAGTGGACGCTGCTGCAGGAGCAGAAGTCGGCCAAGAGCAGCCGCCTCCCAGACATCTTTGAGGCCCAGATTGCTGGCCTTCGGGGTCAGCTTGAGGCACTGCAGGTGGATGGGGGCCGCCTGGAGGCGGAGCTGCGGAGCATGCAGGATGTGGTGGAGGACTTCAAGAATAAGTACGAAGATGAAATTAACCACCGCACAGCTGCTGAGAATGAGTTTGTGGTGCTGAAGAAGGATGTGGATGCTGCCTACATGAGCAAGGTGGAGCTGGAGGCCAAGGTGGATGCCCTGAATGATGAGATCAACTTCCTCAGGACCCTCAATGAGACGGAGTTGACAGAGCTGCAGTCCCAGATCTCCGACACATCTGTGGTGCTGTCCATGGACAACAGTCGCTCCCTGGACCTGGACGGCATCATCGCTGAGGTCAAGGCGCAGTATGAGGAGATGGCCAAATGCAGCCGGGCTGAGGCTGAAGCCTGGTACCAGACCAAGTTTGAGACCCTCCAGGCCCAGGCTGGGAAGCATGGGGACGACCTCCGGAATACCCGGAATGAGATTTCAGAGATGAACCGGGCCATCCAGAGGCTGCAGGCTGAGATCGACAACATCAAGAACCAGCGTGCCAAGTTGGAGGCCGCCATTGCCGAGGCTGAGGAGCGTGGGGAGCTGGCGCTCAAGGATGCTCGTGCCAAGCAGGAGGAGCTGGAAGCCGCCCTGCAGCGGGGCAAGCAGGATATGGCACGGCAGCTGCGTGAGTACCAGGAACTCATGAGCGTGAAGCTGGCCCTGGACATCGAGATCGCCACCTACCGCAAGCTGCTGGAGGGCGAGGAGAGCCGGTTGGCTGGAGATGGAGTGGGAGCCGTGAATATCTCTGTGATGAATTCCACTGGTGGCAGTAGCAGTGGCGGTGGCATTGGGCTGACCCTCGGGGGAACCATGGGCAGCAATGCCCTGAGCTTCTCCAGCAGTGCGGGTCCTGGGCTCCTGAAGGCTTATTCCATCCGGACCGCATCCGCCAGTCGCAGGAGTGCCCGCGACTGAGCCGCCTCCCACCACTCCACTCCTCCAGCCACCACCCACAATCACAAGAAGATTCCCACCCCTGCCTCCCATGCCTGGTCCCAAGACAGTGAGACAGTCTGGAAAGTGATGTCAGAATAGCTTCCAATAAAGCAGCCTCATTCTGAGGCCTGAGTGATCCA