Transcript asmbl_35518

Sequence
Transcript Sequence for observation asmbl_35518 of TGE0056512:
GTATAATAAATGCTACTTGTAAACAAGGCTAGAAAGGGTGGAGAATGAAATGAGATGGGGGGTGGGGAAACAAACCCTTTAGTTACAATATCTTAGGGAAATGAATCTACAATAAGACAAATTTCAAATCAAGTTGCTCCACTATACTGCATAAGCAGTTTAGAATCTTAAGCAGATGCAAAAAGAATAAAGCAAATGGGAGGAAAAAAAAGGCCGATAAAGTTTCTGGCTACAATACAAGAGACATATCATTACCATATGATCTAATGTGGGTGTCAGCCGGATTGTGTTCATTGAGGGAAACCTTATTTTTTAACTGTGCTATGGAGTAGAAGCAGGAGGTTTTCAACCTAGTCACAGAGCAGCACCTACCCCCTCCTCCTTTCCACACCTGCAAACTCTTTTACTTGGGCTGAATATTTAGTGTAATTACATCTCAGCTTTGAGGGCTCCTGTGGCAAATTCCCGGATTAAAAGGTTCCCTGGTTGTGAAAATACATGAGATAAATCATGAAGGCCACTATCATCCTCCTTCTGCTTGCACAAGTTTCCTGGGCTGGACCGTTTCAACAGAGAGGCTTATTTGACTTTATGCTAGAAGATGAGGCTTCTGGGATAGGCCCAGAAGTTCCTGATGACCGCGACTTCGAGCCCTCCCTAGGCCCAGTGTGCCCCTTCCGCTGTCAATGCCATCTTCGAGTGGTCCAGTGTTCTGATTTGGGTCTGGACAAAGTGCCAAAGGATCTTCCCCCTGACACAACTCTGCTAGACCTGCAAAACAACAAAATAACCGAAATCAAAGATGGAGACTTTAAGAACCTGAAGAACCTTCACGCATTGATTCTTGTCAACAATAAAATTAGCAAAGTTAGTCCTGGAGCATTTACACCTTTGGTGAAGTTGGAACGACTTTATCTGTCCAAGAATCAGCTGAAGGAATTGCCAGAAAAAATGCCCAAAACTCTTCAGGAGCTGCGTGCCCATGAGAATGAGATCACCAAAGTGCGAAAAGTTACTTTCAATGGACTGAACCAGATGATTGTCATAGAACTGGGCACCAATCCGCTGAAGAGCTCAGGAATTGAAAATGGGGCTTTCCAGGGAATGAAGAAGCTCTCCTACATCCGCATTGCTGATACCAATATCACCAGCATTCCTCAAGGTCTTCCTCCTTCCCTTACGGAATTACATCTTGATGGCAACAAAATCAGCAGAGTTGATGCAGCTAGCCTGAAAGGACTGAATAATTTGGCTAAGTTGGGATTGAGTTTCAACAGCATCTCTGCTGTTGACAATGGCTCTCTGGCCAACACGCCTCATCTGAGGGAGCTTCACTTGGACAACAACAAGCTTACCAGAGTACCTGGTGGGCTGGCAGAGCATAAGTACATCCAGGTAATGCAAAGCCACTGCTTATGTGAGGAATATCCAAAAAGCAAGACCCCCACCCTGCTTATGGGATGCTGGGAAGCAGGAAGCTCTTCTTAGAAGTTTTTTTTCCAGAGTGTCTTAGTTAGAATTTCTATGACAAAATACCATAAAAAAAATTAAATCATGAAGCACAATTTACATTAGCTAGATTTCAATAAAGTTTTTGATTTAGAAGTATGGAGATGAAACTTAAAGTCTTCTGTAATGCTGATATTTTTTTCAGTAGGGGTGGTGATGTTGGTGCCATAGTGAGTAGGGGGAGTTTGAAGCCACAAGTAAAATAAAAATTCTTTTTTTTTACTGTCACTAATTTTAATTTTCAAATTATTCAAGAATTGACTGGAAAGAGCTTCTTTGGTCTAGCTCCTGATTCTTTTTGACATGGCCTCATCATTTTTCTTTATTTCCTCTAAAAAAAAAATGAGATACGTTTGCAGAATGTGCAGGTTTGTTATATAGGTATACGTGTGCCATGGTGGTTTGCTGGCCCTACTGACCCATCCTCTAAGTTCGCCCGCTCACCCCCTACCCCCTGTTGTGTGTTTTGTTACCCTCTCTGTGTCCGTGTGTTCTCAGCATTCAACTTCCATTTATGCGTGAGAACATGCAGTATTTGGTTTTCTGTTCCTGTGTTAGTTTGCTGAGGATGATGGC