Transcript asmbl_35517

Sequence
Transcript Sequence for observation asmbl_35517 of TGE0056512:
ACCAAGTTGAGGTTTTCAATCTGCTTTTTTTATATCAGAAATTCGATACTGAAAAAAAGCTAATTTTGTGTTTTAAAAAATCAGACTGATTGCTTGGAACAAATGGAATAAATCGTCTTGTCAATAAAGTGATGGTCAATTGAGTCATTTGTGTGCAAAATATTGTGCAAGGCCCGGGTACAGAACAAGGAATAATAAGACACGCCCTGAAGGAGTACATCGTCTAGTGAGGGACAGACCAAGCACGCAAAACAAATTGCAATATAATGTGATAAGTTCTTTAAAAGAGGTAAGAGCAACGTGCTTTGGGAGCAGAGAAGAGGGAGAAAGCAGCATCTTGCCTGGATGAGCCAGGGGACACAGAAGAGAAGCCCACTATCTCATTTAATCTTTACAACTCTCTTGCAAGGTTCCCTGGTTGTGAAAATACATGAGATAAATCATGAAGGCCACTATCATCCTCCTTCTGCTTGCACAAGTTTCCTGGGCTGGACCGTTTCAACAGAGAGGCTTATTTGACTTTATGCTAGAAGATGAGGCTTCTGGGATAGGCCCAGAAGTTCCTGATGACCGCGACTTCGAGCCCTCCCTAGGCCCAGTGTGCCCCTTCCGCTGTCAATGCCATCTTCGAGTGGTCCAGTGTTCTGATTTGGGTCTGGACAAAGTGCCAAAGGATCTTCCCCCTGACACAACTCTGCTAGACCTGCAAAACAACAAAATAACCGAAATCAAAGATGGAGACTTTAAGAACCTGAAGAACCTTCACGCATTGATTCTTGTCAACAATAAAATTAGCAAAGTTAGTCCTGGAGCATTTACACCTTTGGTGAAGTTGGAACGACTTTATCTGTCCAAGAATCAGCTGAAGGAATTGCCAGAAAAAATGCCCAAAACTCTTCAGGAGCTGCGTGCCCATGAGAATGAGATCACCAAAGTGCGAAAAGTTACTTTCAATGGACTGAACCAGATGATTGTCATAGAACTGGGCACCAATCCGCTGAAGAGCTCAGGAATTGAAAATGGGGCTTTCCAGGGAATGAAGAAGCTCTCCTACATCCGCATTGCTGATACCAATATCACCAGCATTCCTCAAGGTCTTCCTCCTTCCCTTACGGAATTACATCTTGATGGCAACAAAATCAGCAGAGTTGATGCAGCTAGCCTGAAAGGACTGAATAATTTGGCTAAGTTGGGATTGAGTTTCAACAGCATCTCTGCTGTTGACAATGGCTCTCTGGCCAACACGCCTCATCTGAGGGAGCTTCACTTGGACAACAACAAGCTTACCAGAGTACCTGGTGGGCTGGCAGAGCATAAGTACATCCAGGTAATGCAAAGCCACTGCTTATGTGAGGAATATCCAAAAAGCAAGACCCCCACCCTGCTTATGGGATGCTGGGAAGCAGGAAGCTCTTCTTAGAAGTTTTTTTTCCAGAGTGTCTTAGTTAGAATTTCTATGACAAAATACCATAAAAAAAATTAAATCATGAAGCACAATTTACATTAGCTAGATTTCAATAAAGTTTTTGATTTAGAAGTATGGAGATGAAACTTAAAGTCTTCTGTAATGCTGATATTTTTTTCAGTAGGGGTGGTGATGTTGGTGCCATAGTGAGTAGGGGGAGTTTGAAGCCACAAGTAAAATAAAAATTCTTTTTTTTTACTGTCACTAATTTTAATTTTCAAATTATTCAAGAATTGACTGGAAAGAGCTTCTTTGGTCTAGCTCCTGATTCTTTTTGACATGGCCTCATCATTTTTCTTTATTTCCTCTAAAAAAAAAATGAGATACGTTTGCAGAATGTGCAGGTTTGTTATATAGGTATACGTGTGCCATGGTGGTTTGCTGGCCCTACTGACCCATCCTCTAAGTTCGCCCGCTCACCCCCTACCCCCTGTTGTGTGTTTTGTTACCCTCTCTGTGTCCGTGTGTTCTCAGCATTCAACTTCCATTTATGCGTGAGAACATGCAGTATTTGGTTTTCTGTTCCTGTGTTAGTTTGCTGAGGATGATGGC