Transcript asmbl_35516

Sequence
Transcript Sequence for observation asmbl_35516 of TGE0056186:
CAGTAACTGAATGAGAGTGGGCTGCTAGAAGAAGCTTAATGTTGAACTTAAAGTGGCAGTGTGAATAATAATCTTTATGATATTTTGTTAAATGAAAAGCCACAAGCCTGTATTCAACATGTGCTGCCTTAGACACATATCAGTAGTAAATATAAACTAAGAACAAACATGTAAGAAACTGAAAAACATTTGTTTCTTCTCTAGAGAATCTAGGCAAAAATTCCCAGAAGATACCTTAAGGTTCCCTGGTTGTGAAAATACATGAGATAAATCATGAAGGCCACTATCATCCTCCTTCTGCTTGCACAAGTTTCCTGGGCTGGACCGTTTCAACAGAGAGGCTTATTTGACTTTATGCTAGAAGATGAGGCTTCTGGGATAGGCCCAGAAGTTCCTGATGACCGCGACTTCGAGCCCTCCCTAGGCCCAGTGTGCCCCTTCCGCTGTCAATGCCATCTTCGAGTGGTCCAGTGTTCTGATTTGGGTCTGGACAAAGTGCCAAAGGATCTTCCCCCTGACACAACTCTGCTAGACCTGCAAAACAACAAAATAACCGAAATCAAAGATGGAGACTTTAAGAACCTGAAGAACCTTCACGCATTGATTCTTGTCAACAATAAAATTAGCAAAGTTAGTCCTGGAGCATTTACACCTTTGGTGAAGTTGGAACGACTTTATCTGTCCAAGAATCAGCTGAAGGAATTGCCAGAAAAAATGCCCAAAACTCTTCAGGAGCTGCGTGCCCATGAGAATGAGATCACCAAAGTGCGAAAAGTTACTTTCAATGGACTGAACCAGATGATTGTCATAGAACTGGGCACCAATCCGCTGAAGAGCTCAGGAATTGAAAATGGGGCTTTCCAGGGAATGAAGAAGCTCTCCTACATCCGCATTGCTGATACCAATATCACCAGCATTCCTCAAGGTCTTCCTCCTTCCCTTACGGAATTACATCTTGATGGCAACAAAATCAGCAGAGTTGATGCAGCTAGCCTGAAAGGACTGAATAATTTGGCTAAGTTGGGATTGAGTTTCAACAGCATCTCTGCTGTTGACAATGGCTCTCTGGCCAACACGCCTCATCTGAGGGAGCTTCACTTGGACAACAACAAGCTTACCAGAGTACCTGGTGGGCTGGCAGAGCATAAGTACATCCAGGTTGTCTACCTTCATAACAACAATATCTCTGTAGTTGGATCAAGTGACTTCTGCCCACCTGGACACAACACCAAAAAGGCTTCTTATTCGGGTGTGAGTCTTTTCAGCAACCCGGTCCAGTACTGGGAGATACAGCCATCCACCTTCAGATGTGTCTACGTGCGCTCTGCCATTCAACTCGGAAACTATAAGTAATTCTCAAGAAAGCCCTCATTTTTATAACCTGGCAAAATCTTGTTAATGTCATTGCTAAAAAATAAATAAAAGCTAGATACTGGAAACCTAACTGCAATGTGGATGTTTTACCCACATGACTTATTATGCATAAAGCCAAATTTCCAGTTTAAGTAATTGCCTACAATAAAAAGAAATTTTGCCTGCCATTTTCAGAATCATCTTTTGAAGCTTTCTGTTGATGTTAACTGAGCTACTAGAGATATTCTTATTTCACTAAATGTAAAATTTGGAGTAAATATATATGTCAATATTTAGTAAAGCTTTTCTTTTTTAATTTCCAGGAAAAAATAAAAAGAGTATGAGTCTTCTGTAATTCATTGAGCAGTTAGCTCATTTGAGATAAAGTCAAATGCCAAACACTAGCTCTGTATTAATCCCCATCATTACTGGTAAAGCCTCATTTGAATGTGTGAATTCAATACAGGCTATGTAAAATTTTTACTAATGTCATTATTTTGAAAAAATAAATTTAAAAATACATTCAAAATTACTATTGTATACAAGCTTAATTGTTAATATTCCCTAAACACAATTTTATGAAGGGAGAAGACATTGGTTTGTTGACAATAACAGTACATCTTTTCAAGTTCTCAGCTATTTCTTCTACCTCTCCCTATCTTACATTTGAGTATGGTAACTTATGTCATCTATGTTGAATGTAAGCTTATAAAGCACAAAGCATACATTTCCTGACTGGTCTAGAGAACTGATGTTTCAATTTACCCCTCTGCTAAATAAATATTAAAACTATCATGTGACTTCATGTAATCAGGCTGAACATTTCTACAATTACTAGATGTATTAGACGTAAGTATTTTCTTTAGTTAAACCACCCATGTTAGAAATGTTTTCTGTAGAATTTATAAACAACTATCAATGCAGACAATTTAATAAGCCTGGGGATGATTTACTTACAGTAAACATTTATCAAATTGTACATTTGTGCTATCAACAATTAATAAGCAAATATGTGAAAATAGTTTCTGTCTTCTATGAAGTTAGATATTTGATGGTTAAAACCCCTATAAATCATAGTTTCATATGGGAAAAAATAATTGAAATACAGTGTAAATTTAAATAATTTATTAAGTATAGCAAATAATTGAAATATGGTGGACTAAATTTTGTCATAGAAATATGTGCAAGTTATAGTAGTGGCTCACATGAGAGGTAATCAATTCTGCTAATAGTAGCAGAATGAGTGCAGTGGAACATGAAAAACTTGAGGAGATAACAGTTGAGGTGGGTTTCCATAGATGCATAATAGTTCAAGAGCAAGATTTGGTGGGGAGGCACTATTCAAGACAGGGACTAAGTTCAAAATCCAAGACGTATGCTGGGACACACCTCTGACAGGTTGGCATAAAGGAGGCTTAATCAAACTATTTTTCTTCTTCTGAAACAGAAGCAATAATTTTCATTTACATTTGACATATCCCGAGGTAATATTAACATTAGGGAAAGTTACTCTTTTCCATCTTTCCACATTCTTGCAGGACCATAAAATCTGAATTTTCCAGTATTTTTAATAAGAGGGAAGAAACCTCTCTTTTTCTTCTCTTTTTCATCTCCCAAGAGATCCTCCTCTCATGACTACAGTTGAATAGGTGGTTTCTATTGGAAGACATTCAGGAATTCAAGGTGCATGTCCATAAATGGACTTTTTTTGTTGTTGTTCAGAGCTGGACCTTGAATGATGCATCCTTCTCTCTGTTGTAACCATGAATAATGCACCCTTCATGCTATAGCCTTTAACGATTCACCCTTCTTATTGTAACCTTGAATGATTCACCCTTTATGGTGTAGCCTTGAGTGACGCACCCTTCATGTTGTAGCCTTCAATGATGCACACTCCATGTTATAGCCTTGAATGATATACCCTTTATGCTGCAGCCTTTCTCTTATGGGGAAAAGCCTGCAGATATCCTGCTGCTTAACTGACAAGTGTGGTGAGAAATAAGTAGAAATCTAAAGAGGGGAAGACCATTTTGGACACTTATCTGCAAGGCAGATCCAACACACTTTTCCAGTAGTCAAGCTACTTCTAATTTTGTTCAGTATCAAAATGAGAAACAGGCCTGATTCTCCAGCACTCTTGTCAACACAACTTCCC