Transcript asmbl_35515

Sequence
Transcript Sequence for observation asmbl_35515 of TGE0056186:
GCCATAGGAAGTTAATAAATGGTTTATAGTAGAAATTAATAAGACAAAATTGAATTTTTAGACGATGACTCAGGCAGCAAAATGGAAGATGGACTGAAATAGAGGAAATATGCAAGGCAGAGATGAATTAGAAGCTCTTGTAGTAGTTTAGGGAGAGATGAGAAGGGCCTGGATCAAAATAATTGTGGTAGGATGGAGAGATGTGACTGGCTTCCAGAGATATTTCTGAAGCAGAAATTGGAGATCTCCTATGTGGATAGAGATAATTTTATCTGACCATGTGTTAAGTTCCCTGGTTGTGAAAATACATGAGATAAATCATGAAGGCCACTATCATCCTCCTTCTGCTTGCACAAGTTTCCTGGGCTGGACCGTTTCAACAGAGAGGCTTATTTGACTTTATGCTAGAAGATGAGGCTTCTGGGATAGGCCCAGAAGTTCCTGATGACCGCGACTTCGAGCCCTCCCTAGGCCCAGTGTGCCCCTTCCGCTGTCAATGCCATCTTCGAGTGGTCCAGTGTTCTGATTTGGGTCTGGACAAAGTGCCAAAGGATCTTCCCCCTGACACAACTCTGCTAGACCTGCAAAACAACAAAATAACCGAAATCAAAGATGGAGACTTTAAGAACCTGAAGAACCTTCACGCATTGATTCTTGTCAACAATAAAATTAGCAAAGTTAGTCCTGGAGCATTTACACCTTTGGTGAAGTTGGAACGACTTTATCTGTCCAAGAATCAGCTGAAGGAATTGCCAGAAAAAATGCCCAAAACTCTTCAGGAGCTGCGTGCCCATGAGAATGAGATCACCAAAGTGCGAAAAGTTACTTTCAATGGACTGAACCAGATGATTGTCATAGAACTGGGCACCAATCCGCTGAAGAGCTCAGGAATTGAAAATGGGGCTTTCCAGGGAATGAAGAAGCTCTCCTACATCCGCATTGCTGATACCAATATCACCAGCATTCCTCAAGGTCTTCCTCCTTCCCTTACGGAATTACATCTTGATGGCAACAAAATCAGCAGAGTTGATGCAGCTAGCCTGAAAGGACTGAATAATTTGGCTAAGTTGGGATTGAGTTTCAACAGCATCTCTGCTGTTGACAATGGCTCTCTGGCCAACACGCCTCATCTGAGGGAGCTTCACTTGGACAACAACAAGCTTACCAGAGTACCTGGTGGGCTGGCAGAGCATAAGTACATCCAGGTTGTCTACCTTCATAACAACAATATCTCTGTAGTTGGATCAAGTGACTTCTGCCCACCTGGACACAACACCAAAAAGGCTTCTTATTCGGGTGTGAGTCTTTTCAGCAACCCGGTCCAGTACTGGGAGATACAGCCATCCACCTTCAGATGTGTCTACGTGCGCTCTGCCATTCAACTCGGAAACTATAAGTAATTCTCAAGAAAGCCCTCATTTTTATAACCTGGCAAAATCTTGTTAATGTCATTGCTAAAAAATAAATAAAAGCTAGATACTGGAAACCTAACTGCAATGTGGATGTTTTACCCACATGACTTATTATGCATAAAGCCAAATTTCCAGTTTAAGTAATTGCCTACAATAAAAAGAAATTTTGCCTGCCATTTTCAGAATCATCTTTTGAAGCTTTCTGTTGATGTTAACTGAGCTACTAGAGATATTCTTATTTCACTAAATGTAAAATTTGGAGTAAATATATATGTCAATATTTAGTAAAGCTTTTCTTTTTTAATTTCCAGGAAAAAATAAAAAGAGTATGAGTCTTCTGTAATTCATTGAGCAGTTAGCTCATTTGAGATAAAGTCAAATGCCAAACACTAGCTCTGTATTAATCCCCATCATTACTGGTAAAGCCTCATTTGAATGTGTGAATTCAATACAGGCTATGTAAAATTTTTACTAATGTCATTATTTTGAAAAAATAAATTTAAAAATACATTCAAAATTACTATTGTATACAAGCTTAATTGTTAATATTCCCTAAACACAATTTTATGAAGGGAGAAGACATTGGTTTGTTGACAATAACAGTACATCTTTTCAAGTTCTCAGCTATTTCTTCTACCTCTCCCTATCTTACATTTGAGTATGGTAACTTATGTCATCTATGTTGAATGTAAGCTTATAAAGCACAAAGCATACATTTCCTGACTGGTCTAGAGAACTGATGTTTCAATTTACCCCTCTGCTAAATAAATATTAAAACTATCATGTGACTTCATGTAATCAGGCTGAACATTTCTACAATTACTAGATGTATTAGACGTAAGTATTTTCTTTAGTTAAACCACCCATGTTAGAAATGTTTTCTGTAGAATTTATAAACAACTATCAATGCAGACAATTTAATAAGCCTGGGGATGATTTACTTACAGTAAACATTTATCAAATTGTACATTTGTGCTATCAACAATTAATAAGCAAATATGTGAAAATAGTTTCTGTCTTCTATGAAGTTAGATATTTGATGGTTAAAACCCCTATAAATCATAGTTTCATATGGGAAAAAATAATTGAAATACAGTGTAAATTTAAATAATTTATTAAGTATAGCAAATAATTGAAATATGGTGGACTAAATTTTGTCATAGAAATATGTGCAAGTTATAGTAGTGGCTCACATGAGAGGTAATCAATTCTGCTAATAGTAGCAGAATGAGTGCAGTGGAACATGAAAAACTTGAGGAGATAACAGTTGAGGTGGGTTTCCATAGATGCATAATAGTTCAAGAGCAAGATTTGGTGGGGAGGCACTATTCAAGACAGGGACTAAGTTCAAAATCCAAGACGTATGCTGGGACACACCTCTGACAGGTTGGCATAAAGGAGGCTTAATCAAACTATTTTTCTTCTTCTGAAACAGAAGCAATAATTTTCATTTACATTTGACATATCCCGAGGTAATATTAACATTAGGGAAAGTTACTCTTTTCCATCTTTCCACATTCTTGCAGGACCATAAAATCTGAATTTTCCAGTATTTTTAATAAGAGGGAAGAAACCTCTCTTTTTCTTCTCTTTTTCATCTCCCAAGAGATCCTCCTCTCATGACTACAGTTGAATAGGTGGTTTCTATTGGAAGACATTCAGGAATTCAAGGTGCATGTCCATAAATGGACTTTTTTTGTTGTTGTTCAGAGCTGGACCTTGAATGATGCATCCTTCTCTCTGTTGTAACCATGAATAATGCACCCTTCATGCTATAGCCTTTAACGATTCACCCTTCTTATTGTAACCTTGAATGATTCACCCTTTATGGTGTAGCCTTGAGTGACGCACCCTTCATGTTGTAGCCTTCAATGATGCACACTCCATGTTATAGCCTTGAATGATATACCCTTTATGCTGCAGCCTTTCTCTTATGGGGAAAAGCCTGCAGATATCCTGCTGCTTAACTGACAAGTGTGGTGAGAAATAAGTAGAAATCTAAAGAGGGGAAGACCATTTTGGACACTTATCTGCAAGGCAGATCCAACACACTTTTCCAGTAGTCAAGCTACTTCTAATTTTGTTCAGTATCAAAATGAGAAACAGGCCTGATTCTCCAGCACTCTTGTCAACACAACTTCCC