Transcript asmbl_35514

Sequence
Transcript Sequence for observation asmbl_35514 of TGE0056186:
GTATAATAAATGCTACTTGTAAACAAGGCTAGAAAGGGTGGAGAATGAAATGAGATGGGGGGTGGGGAAACAAACCCTTTAGTTACAATATCTTAGGGAAATGAATCTACAATAAGACAAATTTCAAATCAAGTTGCTCCACTATACTGCATAAGCAGTTTAGAATCTTAAGCAGATGCAAAAAGAATAAAGCAAATGGGAGGAAAAAAAAGGCCGATAAAGTTTCTGGCTACAATACAAGAGACATATCATTACCATATGATCTAATGTGGGTGTCAGCCGGATTGTGTTCATTGAGGGAAACCTTATTTTTTAACTGTGCTATGGAGTAGAAGCAGGAGGTTTTCAACCTAGTCACAGAGCAGCACCTACCCCCTCCTCCTTTCCACACCTGCAAACTCTTTTACTTGGGCTGAATATTTAGTGTAATTACATCTCAGCTTTGAGGGCTCCTGTGGCAAATTCCCGGATTAAAAGGTTCCCTGGTTGTGAAAATACATGAGATAAATCATGAAGGCCACTATCATCCTCCTTCTGCTTGCACAAGTTTCCTGGGCTGGACCGTTTCAACAGAGAGGCTTATTTGACTTTATGCTAGAAGATGAGGCTTCTGGGATAGGCCCAGAAGTTCCTGATGACCGCGACTTCGAGCCCTCCCTAGGCCCAGTGTGCCCCTTCCGCTGTCAATGCCATCTTCGAGTGGTCCAGTGTTCTGATTTGGGTCTGGACAAAGTGCCAAAGGATCTTCCCCCTGACACAACTCTGCTAGACCTGCAAAACAACAAAATAACCGAAATCAAAGATGGAGACTTTAAGAACCTGAAGAACCTTCACGCATTGATTCTTGTCAACAATAAAATTAGCAAAGTTAGTCCTGGAGCATTTACACCTTTGGTGAAGTTGGAACGACTTTATCTGTCCAAGAATCAGCTGAAGGAATTGCCAGAAAAAATGCCCAAAACTCTTCAGGAGCTGCGTGCCCATGAGAATGAGATCACCAAAGTGCGAAAAGTTACTTTCAATGGACTGAACCAGATGATTGTCATAGAACTGGGCACCAATCCGCTGAAGAGCTCAGGAATTGAAAATGGGGCTTTCCAGGGAATGAAGAAGCTCTCCTACATCCGCATTGCTGATACCAATATCACCAGCATTCCTCAAGGTCTTCCTCCTTCCCTTACGGAATTACATCTTGATGGCAACAAAATCAGCAGAGTTGATGCAGCTAGCCTGAAAGGACTGAATAATTTGGCTAAGTTGGGATTGAGTTTCAACAGCATCTCTGCTGTTGACAATGGCTCTCTGGCCAACACGCCTCATCTGAGGGAGCTTCACTTGGACAACAACAAGCTTACCAGAGTACCTGGTGGGCTGGCAGAGCATAAGTACATCCAGGTTGTCTACCTTCATAACAACAATATCTCTGTAGTTGGATCAAGTGACTTCTGCCCACCTGGACACAACACCAAAAAGGCTTCTTATTCGGGTGTGAGTCTTTTCAGCAACCCGGTCCAGTACTGGGAGATACAGCCATCCACCTTCAGATGTGTCTACGTGCGCTCTGCCATTCAACTCGGAAACTATAAGTAATTCTCAAGAAAGCCCTCATTTTTATAACCTGGCAAAATCTTGTTAATGTCATTGCTAAAAAATAAATAAAAGCTAGATACTGGAAACCTAACTGCAATGTGGATGTTTTACCCACATGACTTATTATGCATAAAGCCAAATTTCCAGTTTAAGTAATTGCCTACAATAAAAAGAAATTTTGCCTGCCATTTTCAGAATCATCTTTTGAAGCTTTCTGTTGATGTTAACTGAGCTACTAGAGATATTCTTATTTCACTAAATGTAAAATTTGGAGTAAATATATATGTCAATATTTAGTAAAGCTTTTCTTTTTTAATTTCCAGGAAAAAATAAAAAGAGTATGAGTCTTCTGTAATTCATTGAGCAGTTAGCTCATTTGAGATAAAGTCAAATGCCAAACACTAGCTCTGTATTAATCCCCATCATTACTGGTAAAGCCTCATTTGAATGTGTGAATTCAATACAGGCTATGTAAAATTTTTACTAATGTCATTATTTTGAAAAAATAAATTTAAAAATACATTCAAAATTACTATTGTATACAAGCTTAATTGTTAATATTCCCTAAACACAATTTTATGAAGGGAGAAGACATTGGTTTGTTGACAATAACAGTACATCTTTTCAAGTTCTCAGCTATTTCTTCTACCTCTCCCTATCTTACATTTGAGTATGGTAACTTATGTCATCTATGTTGAATGTAAGCTTATAAAGCACAAAGCATACATTTCCTGACTGGTCTAGAGAACTGATGTTTCAATTTACCCCTCTGCTAAATAAATATTAAAACTATCATGTGACTTCATGTAATCAGGCTGAACATTTCTACAATTACTAGATGTATTAGACGTAAGTATTTTCTTTAGTTAAACCACCCATGTTAGAAATGTTTTCTGTAGAATTTATAAACAACTATCAATGCAGACAATTTAATAAGCCTGGGGATGATTTACTTACAGTAAACATTTATCAAATTGTACATTTGTGCTATCAACAATTAATAAGCAAATATGTGAAAATAGTTTCTGTCTTCTATGAAGTTAGATATTTGATGGTTAAAACCCCTATAAATCATAGTTTCATATGGGAAAAAATAATTGAAATACAGTGTAAATTTAAATAATTTATTAAGTATAGCAAATAATTGAAATATGGTGGACTAAATTTTGTCATAGAAATATGTGCAAGTTATAGTAGTGGCTCACATGAGAGGTAATCAATTCTGCTAATAGTAGCAGAATGAGTGCAGTGGAACATGAAAAACTTGAGGAGATAACAGTTGAGGTGGGTTTCCATAGATGCATAATAGTTCAAGAGCAAGATTTGGTGGGGAGGCACTATTCAAGACAGGGACTAAGTTCAAAATCCAAGACGTATGCTGGGACACACCTCTGACAGGTTGGCATAAAGGAGGCTTAATCAAACTATTTTTCTTCTTCTGAAACAGAAGCAATAATTTTCATTTACATTTGACATATCCCGAGGTAATATTAACATTAGGGAAAGTTACTCTTTTCCATCTTTCCACATTCTTGCAGGACCATAAAATCTGAATTTTCCAGTATTTTTAATAAGAGGGAAGAAACCTCTCTTTTTCTTCTCTTTTTCATCTCCCAAGAGATCCTCCTCTCATGACTACAGTTGAATAGGTGGTTTCTATTGGAAGACATTCAGGAATTCAAGGTGCATGTCCATAAATGGACTTTTTTTGTTGTTGTTCAGAGCTGGACCTTGAATGATGCATCCTTCTCTCTGTTGTAACCATGAATAATGCACCCTTCATGCTATAGCCTTTAACGATTCACCCTTCTTATTGTAACCTTGAATGATTCACCCTTTATGGTGTAGCCTTGAGTGACGCACCCTTCATGTTGTAGCCTTCAATGATGCACACTCCATGTTATAGCCTTGAATGATATACCCTTTATGCTGCAGCCTTTCTCTTATGGGGAAAAGCCTGCAGATATCCTGCTGCTTAACTGACAAGTGTGGTGAGAAATAAGTAGAAATCTAAAGAGGGGAAGACCATTTTGGACACTTATCTGCAAGGCAGATCCAACACACTTTTCCAGTAGTCAAGCTACTTCTAATTTTGTTCAGTATCAAAATGAGAAACAGGCCTGATTCTCCAGCACTCTTGTCAACACAACTTCCC