Transcript asmbl_35328

Sequence
Transcript Sequence for observation asmbl_35328 of TGE0057009:
GCAGGCGGCTGCGGTTGCTGCAGCCTTCAGTCTCCACCCGGACTACGCCATGTTGGGGTTTGTGGGTCGGGTGGCCGCTGCTCCGGCCTCCGGGGCCTTGCGGAGACTCACCCCTTCAGCGTCGCTGCCCCCAGCTCAGCTCTTACTGCGGGCCGCTCCGACGGCGGTCCATCCTGTCAGGGACTATGCGGCGCAAACATCTCCTTCGCCAAAAGCAGGCGCCGCCACCGGGCGCATCGTGGCGGTCATTGGCGCAGTGGTGGACGTCCAGTTTGATGAGGGACTACCACCAATTCTAAATGCCCTGGAAGTGCAAGGCAGGGAGACCAGACTGGTTTTGGAGGTGGCCCAGCATTTGGGTGAGAGCACAGTAAGGACTATTGCTATGGATGGTACAGAAGGCTTGGTTAGAGGCCAGAAAGTACTGGATTCTGGTGCACCAATCAAAATTCCTGTTGGTCCTGAGACTTTGGGCAGAATCATGAATGTCATTGGAGAACCTATTGATGAAAGAGGTCCCATCAAAACCAAACAATTTGCTCCCATTCATGCTGAGGCTCCAGAGTTCATGGAAATGAGTGTTGAGCAGGAAATTCTGGTGACTGGTATCAAGGTTGTCGATCTGCTAGCTCCCTATGCCAAGGGTGGCAAAATTGGGCTTTTTGGTGGTGCTGGAGTTGGCAAGACTGTACTGATCATGGAGTTAATCAACAATGTCGCCAAAGCCCATGGTGGTTACTCTGTGTTTGCTGGTGTTGGTGAGAGGACCCGTGAAGGCAATGATTTATACCATGAAATGATTGAATCTGGTGTTATCAACTTAAAAGATGCCACCTCTAAGGTAAGCATTGAGCTAATTGATGTCCACGTGGTAGTTACGCCAGGAAACTATTGCCAACTGAAGCCATGTTCTATATTTTCTATTTAATTTTTTTTTCTTTTTAAGAAAATGTTAATATTTTCATTTTCGTGTCCCAGGGCCTACAAAGGAAACCTGTTAGTGTTTTCCCCCCCAACTTCCAATACACAAATGGACATTTTCTTTCCTCTTTGATACTGACATTAAATAACATTTCCAGGTTTTCTTTTTGGTAGATAGTCCCATCATTTGAAAGCTAATTTTGGGAGGGCTGGATTGGACGTGGTACATATGTTTCAGTTAAGCCTATTTTGTACTTTTCACTTAACTTGAATAGGTTTTTATTTCCTTTCTACTATAGTTTTGCCTTACTAATATAAGAAGCTGTCTTTTTTTTTTGAACTGCATCTCTAATAGGGAAAAGAAACTTGCACACAAAAACGCTGACACCTTCTGAGAAAGGATCTGTGGTCGTTTCTCCGATTTGGGAACCTTCAGTATGTGGCTTCTCTACTCCTTTGTCAGGTTTTACGATTATGTATGATTACTGCAGGTAGCGCTGGTATATGGTCAAATGAATGAACCACCTGGTGCTCGTGCCCGGGTAGCTCTGACTGGGCTGACTGTGGCTGAATACTTCAGAGACCAAGAAGGTCAAGATGTACTGCTATTTATTGATAACATCTTTCGCTTCACCCAGGCTGGTTCAGAGGTGTCTGCATTATTGGGCCGAATCCCTTCTGCTGTGGGCTATCAGCCTACCCTGGCCACTGACATGGGTACTATGCAGGAAAGAATTACCACTACCAAGAAGGGATCTATCACCTCTGTACAGGCTATCTATGTGCCTGCTGATGACTTGACTGACCCTGCCCCTGCTACTACGTTTGCCCATTTGGATGCTACCACTGTACTGTCGCGTGCCATTGCTGAGCTGGGCATCTATCCAGCTGTGGATCCTCTAGACTCCACCTCTCGTATCATGGATCCCAACATTGTTGGCAGTGAGCATTACGATGTTGCCCGTGGGGTGCAAAAGATCCTGCAGGACTACAAATCCCTCCAGGATATCATTGCCATCCTGGGTATGGATGAACTTTCTGAGGAAGACAAGTTGACCGTGTCCCGTGCACGGAAAATACAGCGTTTCTTGTCTCAGCCATTCCAGGTTGCTGAGGTCTTCACAGGTCATATGGGGAAGCTGGTACCCCTGAAGGAGACCATCAAAGGATTCCAGCAGATTTTGGCAGGTGAATATGACCATCTCCCAGAACAGGCCTTCTATATGGTGGGACCCATTGAAGAAGCTGTGGCAAAAGCTGATAAGCTGGCTGAAGAGCATTCATCGTGAGGGGTCTTTGTCCTCTGTACTGTCTCTCTCCTTGCCCCTAACCCAAAAAGCTTCATTTTTCTGTGTAGGCTGCACAAGAGCCTTGATTGAAGATATATTCTTTCTGAACAGTATTTAAGGTTTCCAATAAAATGTACACCCCTC