Transcript asmbl_35327

Sequence
Transcript Sequence for observation asmbl_35327 of TGE0059308:
GCAGGCGGCTGCGGTTGCTGCAGCCTTCAGTCTCCACCCGGACTACGCCATGTTGGGGTTTGTGGGTCGGGTGGCCGCTGCTCCGGCCTCCGGGGCCTTGCGGAGACTCACCCCTTCAGCGTCGCTGCCCCCAGCTCAGCTCTTACTGCGGGCCGCTCCGACGGCGGTCCATCCTGTCAGGGACTATGCGGCGCAAACATCTCCTTCGCCAAAAGCAGGCGCCGCCACCGGGCGCATCGTGGCGGTCATTGGCGCAGTGGTGGACGTCCAGTTTGATGAGGGACTACCACCAATTCTAAATGCCCTGGAAGTGCAAGGCAGGGAGACCAGACTGGTTTTGGAGGTGGCCCAGCATTTGGGTGAGAGCACAGTAAGGACTATTGCTATGGATGGTACAGAAGGCTTGGTTAGAGGCCAGAAAGTACTGGATTCTGGTGCACCAATCAAAATTCCTGTTGGTCCTGAGACTTTGGGCAGAATCATGAATGTCATTGGAGAACCTATTGATGAAAGAGGTCCCATCAAAACCAAACAATTTGCTCCCATTCATGCTGAGGCTCCAGAGTTCATGGAAATGAGTGTTGAGCAGGAAATTCTGGTGACTGGTATCAAGGTTGTCGATCTGCTAGCTCCCTATGCCAAGGGTGGCAAAATTGGGCTTTTTGGTGGTGCTGGAGTTGGCAAGACTGTACTGATCATGGAGTTAATCAACAATGTCGCCAAAGCCCATGGTGGTTACTCTGTGTTTGCTGGTGTTGGTGAGAGGACCCGTGAAGGCAATGATTTATACCATGAAATGATTGAATCTGGTGTTATCAACTTAAAAGATGCCACCTCTAAGGTAGCGCTGGTATATGGTCAAATGAATGAACCACCTGGTGCTCGTGCCCGGGTAGCTCTGACTGGGCTGACTGTGGCTGAATACTTCAGAGACCAAGAAGGTCAAGATGTACTGCTATTTATTGATAACATCTTTCGCTTCACCCAGGCTGGTTCAGAGGTGTCTGCATTATTGGGCCGAATCCCTTCTGCTGTGGGCTATCAGCCTACCCTGGCCACTGACATGGGTACTATGCAGGAAAGAATTACCACTACCAAGAAGGGATCTATCACCTCTGTACAGGCTATCTATGTGCCTGCTGATGACTTGACTGACCCTGCCCCTGCTACTACGTTTGCCCATTTGGATGCTACCACTGTACTGTCGCGTGCCATTGCTGAGCTGGGCATCTATCCAGCTGTGGATCCTCTAGACTCCACCTCTCGTATCATGGATCCCAACATTGTTGGCAGTGAGCATTACGATGTTGCCCGTGGGGTGCAAAAGATCCTGCAGGACTACAAATCCCTCCAGGATATCATTGCCATCCTGGGTATGGATGAACTTTCTGAGGAAGACAAGTTGACCGTGTCCCGTGCACGGAAAATACAGCGTTTCTTGTCTCAGCCATTCCAGGTTGCTGAGGTCTTCACAGGTCATATGGGGAAGCTGGTACCCCTGAAGGAGACCATCAAAGGATTCCAGCAGATTTTGGCAGGTGAATATGACCATCTCCCAGAACAGGCCTTCTATATGGTGGGACCCATTGAAGAAGCTGTGGCAAAAGCTGATAAGCTGGCTGAAGAGCATTCATCGTGAGGGGTCTTTGTCCTCTGTACTGTCTCTCTCCTTGCCCCTAACCCAAAAAGCTTCATTTTTCTGTGTAGGCTGCACAAGAGCCTTGATTGAAGATATATTCTTTCTGAACAGTATTTAAGGTTTCCAATAAAATGTACACCCCTC