Transcript asmbl_35298

Sequence
Transcript Sequence for observation asmbl_35298 of TGE0057006:
CCCGGGCTGGGCGCCGCCGCCGGTTCGTCTACTCTTTCCTTCAGCCGCCTCCTTTCAACCTTGTCAACCCGTCGGCGCGGCCTCTGGTGCAGCGGCGGCGGCTCCTGTTCCTGCCGCAGCTCTCTCCCTTTCTTACCTCCCCACCAGATCCCGGAGATCGCCCGCCATGGCTTTACTTACTGCGGCCGCCCGGCTCTTGGGAACCAAGAATGCATCTTGTCTTGTTCTTGCAGCCCGGCATGCCAGTGCTTCCTCCACGAATTTGAAAGACATATTGGCTGACCTGATACCTAAGGAGCAGGCCAGAATTAAGACTTTCAGGCAGCAACATGGCAAGACGGTGGTGGGCCAAATCACTGTGGACATGATGTATGGTGGCATGAGAGGCATGAAGGGATTGGTCTATGAAACATCAGTTCTTGATCCTGATGAGGGCATCCGTTTCCGAGGCTTTAGTATCCCTGAATGCCAGAAACTGCTACCCAAGGCTAAGGGTGGGGAAGAACCCCTGCCTGAGGGCTTATTTTGGCTGCTGGTAACTGGACATATCCCAACAGAGGAACAGGTATCTTGGCTCTCAAAAGAGTGGGCAAAGAGGGCAGCTCTGCCTTCCCATGTGGTCACCATGCTGGACAACTTTCCCACCAATCTACACCCCATGTCTCAGCTCAGTGCAGCTGTTACAGCCCTCAACAGTGAAAGTAACTTTGCCCGAGCATATGCACAGGGTATCAGCCGAACCAAGTACTGGGAGTTGATTTATGAAGACTCTATGGATCTAATCGCAAAGCTACCTTGTGTTGCAGCAAAGATCTACCGAAATCTCTACAGAGAAGGCAGCGGTATTGGGGCCATTGACTCTAACCTGGACTGGTCTCACAATTTCACCAACATGTTAGGCTATACTGATCATCAGTTCACTGAGCTCACGCGCCTGTACCTCACCATCCACAGTGACCATGAGGGTGGCAATGTAAGTGCCCATACCAGCCATTTGGTGGGCAGTGCCCTTTCCGACCCTTACCTGTCCTTTGCAGCAGCCATGAACGGGCTGGCAGGGCCTCTCCATGGACTGGCAAATCAGGAAGTGCTTGTCTGGCTAACACAGCTGCAGAAGGAAGTTGGCAAAGATGTGTCAGATGAGAAGTTACGAGACTACATCTGGAACACACTCAACTCAGGACGGGTTGTTCCAGGCTATGGCCATGCAGTACTAAGGAAGACTGATCCGCGATATACCTGTCAGCGAGAGTTTGCTCTGAAACACCTGCCTAATGACCCCATGTTTAAGTTGGTTGCTCAGCTGTACAAGATTGTGCCCAATGTCCTCTTAGAGCAGGGTAAAGCCAAGAATCCTTGGCCCAATGTAGATGCTCACAGTGGGGTGCTGCTCCAGTATTATGGCATGACGGAGATGAATTACTACACGGTCCTGTTTGGGGTGTCACGAGCATTGGGTGTACTGGCACAGCTCATCTGGAGCCGAGCCTTAGGCTTCCCTCTAGAAAGGCCCAAGTCCATGAGCACAGAGGGTCTGATGAAGTTTGTGGACTCTAAGTCAGGGTAAAACTGGAGACTGGGTGAAAGTGACTACCAGAAAGTGAGGAAGCCTAAATAAAAAGTATACTTTTGTTTCAGGGGGCCTTTAAAGACTTAAGATTAAATTATATCTGAGGCACTGATAATATGTTTGAGGTTAAAATATAAATTAAGACTTTAAAAGATGAAAAATGGTCCCTTCTTCCCTAATCAGCTCCCTTCCCCTGCCTGGTATGAGTTGCCCATCATACGCATGGTCCTGGAGGATGACCAGGACTAATGCATGTGGTATGAGTAGGTTTGGCCCCCTCACTATCTCTAGAGTGAGAATCTGGCTCCTGTTTCCATGGGTCAAAGCCGGTTGCAGAGAATCTGTAGTCACTTTGGAGCTTTAGCTTCTCTGCCAAGCCCTCAATAAGCCAGCAAACCAGGACTCTGCCCCTTCTGTTTCCATAGGAATCATGTTGGATAGTCAGCTGTACCAAGCCCCTTGGCCCTCTCCCATGCACACAAACACCTCCTAGCAAGACCTGTTGGTTAGCTGGACATGCTTTGGCAATTTTTTTATACTACCAAGTGACCATAAAGGCATGGCATTTGTTGTGACTGGCACCCAATGTTTGATTTTTTTTTTAAAACTATCCAATTAAAATTAAGGTCTGGGAGTGTTCTGTTTCCCATTACTTTAATACTCACCTCCTCCCAGACTTTCTACACCTGTTGCACCTCAGGCAGAGGATGTTCTGGACCTCCCCCTCTTGGTCCCTACTAGAGACCTCTCAACAGATCTGTGGGCCCAGTCATTGGGTTTTATCAGTGCTTAATGTGAACTAAGTTTTTTACTTCCACAGAATACAAGCCACTACCTTCTGACCTCCCCACCCCCCACCAACCCCCATCTTTTAATATGCTGTGGGGCATAGAACTCCGGAATGACCAGCATGATATTTTCAGAGTCTTGTCCCCGGGGTATTAGCACCTCTTTTTGAACAGGGAATTGATTCAAGATTGGACATGGTCTCCTCTGATTATCAGGTACTGGGGCTGAGGGCATTAAAAATAGTAAGCCTCCCTCCTCGTCCCCTGCCTCAAGAAATTGCCTCCTTATTTATCAACATCTTTTTCCTCCCTTTCCCTGAGAGCTCACAGTACAATGTTTCAGAAGCCCCATTTGCACAGGTTTTCAGCAACTCAGAATGCTCTACTTCTTTTTCTTTGAGAAAGGATTAAGATACACTCCTGCTGTGCCCCCATCTTTCCTCCAAACTCCTGCCTGTGTTTGTGTGGATACCCAGTCCCAGAACCACACTGTTGAGTTGGACACACTGTAAACCCCTGGGTAACTGTCAAGTCATGATGGAGACTTCAGGTTGTTCTGTATAAAATGCAAAATAAAT