Transcript asmbl_35173

Sequence
Transcript Sequence for observation asmbl_35173 of TGE0059617:
CTGGCCCCCGGGCCTTCAGCAGCCGCTCCTACACGAGTGGGCCCGGTTCCCGCATCAGCTCCTCGAGCTTCTCCCGAGTGGGCAGCAGCAACTTTCGCGGTGGCCTGGGCGGCGGCTATGGTGGGGCCAGCGGCATGGGAGGCATCACCGCAGTTACGGTCAACCAGAGCCTGCTGAGCCCCCTTGTCCTGGAGGTGGACCCCAACATCCAGGCCGTGCGCACCCAGGAGAAGGAGCAGATCAAGACCCTCAACAACAAGTTTGCCTCCTTCATAGACAAGGTACGGTTCCTGGAGCAGCAGAACAAGATGCTGGAGACCAAGTGGAGCCTCCTGCAGCAGCAGAAGACGGCTCGAAGCAACATGGACAACATGTTCGAGAGCTACATCAACAACCTTAGGCGGCAGCTGGAGACTCTGGGCCAGGAGAAGCTGAAGCTGGAGGCGGAGCTTGGCAACATGCAGGGGCTGGTGGAGGACTTCAAGAACAAGTATGAGGATGAGATCAATAAGCGTACAGAGATGGAGAACGAATTTGTCCTCATCAAGAAGGATGTGGATGAAGCTTACATGAACAAGGTAGAGCTGGAGTCTCGCCTGGAAGGGCTGACCGACGAGATCAACTTCCTCAGGCAGCTATATGAAGAGGAGATCCGGGAGCTGCAGTCCCAGATCTCGGACACATCTGTGGTGCTGTCCATGGACAACAGCCGCTCCCTGGACATGGACAGCATCATTGCTGAGGTCAAGGCACAGTACGAGGATATTGCCAACCGCAGCCGGGCTGAGGCTGAGAGCATGTACCAGATCAAGTATGAGGAGCTGCAGAGCCTGGCTGGGAAGCACGGGGATGACCTGCGGCGCACAAAGACTGAGATCTCTGAGATGAACCGGAACATCAGCCGGCTCCAGGCTGAGATTGAGGGCCTCAAAGGCCAGAGGGCTTCCCTGGAGGCCGCCATTGCAGATGCCGAGCAGCGTGGAGAGCTGGCCATTAAGGATGCCAACGCCAAGTTGTCCGAGCTGGAGGCCGCCCTGCAGCGGGCCAAGCAGGACATGGCGCGGCAGCTGCGTGAGTACCAGGAGCTGATGAACGTCAAGCTGGCCCTGGACATCGAGATCGCCACCTACAGGAAGCTGCTGGAGGGCGAGGAGAGCCGGT