Transcript asmbl_34811

Sequence
Transcript Sequence for observation asmbl_34811 of TGE0056179:
AGCTGCTGTACGGTAAAAGTGAGCTCTTACGGGAATGGGAATGTAGTTTTAGCCCTCCAGGGATTCTATTTAGCCCGCCAGGAATTAACCTTGACTATAAATAGGCCATCAATGACCTTTCCAGAGAATGTTCAGAGACCTCAACTTTGTTTAGAGATCTTGTGTGGGTGGAACTTCCTGTTTGCACACAGAGCAGCATAAAGCCCAGTTGCTTTGGGAAGTGTTTGGGACCAGATGGATTGTAGGGAGTAGGGTACAATACAGTCTGTTCTCCTCCAGCTCCTTCTTTCTGCAACATGGGGAAGAACAAACTCCTTCATCCAAGTCTGGTTCTTCTCCTCTTGGTCCTCCTGCCCACAGACGCCTCAGTCTCTGGAAAACCGCAGTATATGGTTCTGGTCCCCTCCCTGCTCCACACTGAGACCACTGAGAAGGGCTGTGTCCTTCTGAGCTACCTGAATGAGACAGTGACTGTAAGTGCTTCCTTGGAGTCTGTCAGGGGAAACAGGAGCCTCTTCACTGACCTGGAGGCGGAGAATGACGTACTCCACTGTGTCGCCTTCGCTGTCCCAAAGTCTTCATCCAATGAGGAGGTAATGTTCCTCACTGTCCAAGTGAAAGGACCAACCCAAGAATTTAAGAAGCGGACCACAGTGATGGTTAAGAACGAGGACAGTCTGGTCTTTGTCCAGACAGACAAATCAATCTACAAACCAGGGCAGACAGTGAAATTTCGTGTTGTCTCCATGGATGAAAACTTTCACCCCCTGAATGAGTTGATTCCACTAGTATACATTCAGGATCCCAAAGGAAATCGCATCGCACAATGGCAGAGTTTCCAGTTAGAGGGTGGCCTCAAGCAATTTTCTTTTCCCCTCTCATCAGAGCCCTTCCAGGGCTCCTACAAGGTGGTGGTACAGAAGAAATCAGGTGGAAGGACAGAGCACCCTTTCACCGTGGAGGAATTTGTTCTTCCCAAGTTTGAAGTACAAGTAACAGTGCCAAAGATAATCACCATCTTGGAAGAAGAGATGAATGTATCAGTGTGTGGCCTATACACATATGGGAAGCCTGTCCCTGGACATGTGACTGTGAGCATTTGCAGAAAGTATAGTGACGCTTCCGACTGCCACGGTGAAGATTCACAGGCTTTCTGTGAGAAATTCAGTGGACAGCTAAACAGCCATGGCTGCTTCTATCAGCAAGTAAAAACCAAGGTCTTCCAGCTGAAGAGGAAGGAGTATGAAATGAAACTTCACACTGAGGCCCAGATCCAAGAAGAAGGAACAGTGGTGGAATTGACTGGAAGGCAGTCCAGTGAAATCACAAGAACCATAACCAAACTCTCATTTGTGAAAGTGGACTCACACTTTCGACAGGGAATTCCCTTCTTTGGGCAGGTGCGCCTAGTAGATGGGAAAGGCGTCCCTATACCAAATAAAGTCATATTCATCAGAGGAAATGAAGCAAACTATTACTCCAATGCTACCACGGATGAGCATGGCCTTGTACAGTTCTCTATCAACACCACCAATGTTATGGGTACCTCTCTTACTGTTAGGGTCAATTACAAGGATCGTAGTCCCTGTTACGGCTACCAGTGGGTGTCAGAAGAACACGAAGAGGCACATCACACTGCTTATCTTGTGTTCTCCCCAAGCAAGAGCTTTGTCCACCTTGAGCCCATGTCTCATGAACTACCCTGTGGCCATACTCAGACAGTCCAGGCACATTATATTCTGAATGGAGGCACCCTGCTGGGGCTGAAGAAGCTCTCCTTCTATTATCTGATAATGGCAAAGGGAGGCATTGTCCGAACTGGGACTCATGGACTGCTTGTGAAGCAGGAAGACATGAAGGGCCATTTTTCCATCTCAATCCCTGTGAAGTCAGACATTGCTCCTGTCGCTCGGTTGCTCATCTATGCTGTTTTACCTACCGGGGACGTGATTGGGGATTCTGCAAAATATGATGTTGAAAATTGTCTGGCCAACAAGGTGGATTTGAGCTTCAGCCCATCACAAAGTCTCCCAGCCTCACACGCCCACCTGCGAGTCACAGCGGCTCCTCAGTCCGTCTGCGCCCTCCGTGCTGTGGACCAAAGCGTGCTGCTCATGAAGCCTGATGCTGAGCTCTCGGCGTCCTCGGTTTACAACCTGCTACCAGAAAAGGACCTCACTGGCTTCCCTGGGCCTTTGAATGACCAGGACAATGAAGACTGCATCAATCGTCATAATGTCTATATTAATGGAATCACATATACTCCAGTATCAAGTACAAATGAAAAGGATATGTACAGCTTCCTAGAGGACATGGGCTTAAAGGCATTCACCAACTCAAAGATTCGTAAACCCAAAATGTGTCCACAGCTTCAACAGTATGAAATGCATGGACCTGAAGGTCTACGTGTAGGTTTTTATGAGTCAGATGTAATGGGAAGAGGCCATGCACGCCTGGTGCATGTTGAAGAGCCTCACACGGAGACCGTACGAAAGTACTTCCCTGAGACATGGATCTGGGATTTGGTGGTGGTAAACTCAGCAGGTGTGGCTGAGGTAGGAGTAACAGTCCCTGACACCATCACCGAGTGGAAGGCAGGGGCCTTCTGCCTGTCTGAAGATGCTGGACTTGGTATCTCTTCCACTGCCTCTCTCCGAGCCTTCCAGCCCTTCTTTGTGGAGCTCACAATGCCTTACTCTGTGATTCGTGGAGAGGCCTTCACACTCAAGGCCACGGTCCTAAACTACCTTCCCAAATGCATCCGGGTCAGTGTGCAGCTGGAAGCCTCTCCCGCCTTCCTAGCTGTCCCAGTGGAGAAGGAACAAGCGCCTCACTGCATCTGTGCAAACGGGCGGCAAACTGTGTCCTGGGCAGTAACCCCAAAGTCATTAGGAAATGTGAATTTCACTGTGAGCGCAGAGGCACTAGAGTCTCAAGAGCTGTGTGGGACTGAGGTGCCTTCAGTTCCTGAACACGGAAGGAAAGACACAGTCATCAAGCCTCTGTTGGTTGAACCTGAAGGACTAGAGAAGGAAACAACATTCAACTCCCTACTTTGTCCATCAGGTGGTGAGGTTTCTGAAGAATTATCCCTGAAACTGCCACCAAATGTGGTAGAAGAATCTGCCCGAGCTTCTGTCTCAGTTTTGGGAGACATATTAGGCTCTGCCATGCAAAACACACAAAATCTTCTCCAGATGCCCTATGGCTGTGGAGAGCAGAATATGGTCCTCTTTGCTCCTAACATCTATGTACTGGATTATCTAAATGAAACACAGCAGCTTACTCCAGAGATCAAGTCCAAGGCCATTGGCTATCTCAACACTGGTTACCAGAGACAGTTGAACTACAAACACTATGATGGCTCCTACAGCACCTTTGGGGAGCGATATGGCAGGAACCAGGGCAACACCTGGCTCACAGCCTTTGTTCTGAAGACTTTTGCCCAAGCTCGAGCCTACATCTTCATCGATGAAGCACACATTACCCAAGCCCTCATATGGCTCTCCCAGAGGCAGAAGGACAATGGCTGTTTCAGGAGCTCTGGGTCACTGCTCAACAATGCCATAAAGGGAGGAGTAGAAGATGAAGTGACCCTCTCCGCCTATATCACCATCGCCCTTCTGGAGATTCCTCTCACAGTCACTCACCCTGTTGTCCGCAATGCCCTGTTTTGCCTGGAGTCAGCCTGGAAGACAGCACAAGAAGGGGACCATGGCAGCCATGTATATACCAAAGCACTGCTGGCCTATGCTTTTGCCCTGGCAGGTAACCAGGACAAGAGGAAGGAAGTACTCAAGTCACTTAATGAGGAAGCTGTGAAGAAAGACAACTCTGTCCATTGGGAGCGCCCTCAGAAACCCAAGGCACCAGTGGGGCATTTTTACGAACCCCAGGCTCCCTCTGCTGAGGTGGAGATGACATCCTATGTGCTCCTCGCTTATCTCACGGCCCAGCCAGCCCCAACCTCGGAGGACCTGACCTCTGCAACCAACATCGTGAAGTGGATCACGAAGCAGCAGAATGCCCAGGGCGGTTTCTCCTCCACCCAGGACACAGTGGTGGCTCTCCATGCTCTGTCCAAATATGGAGCAGCCACATTTACCAGGACTGGGAAGGCTGCACAGGTGACTATCCAGTCTTCAGGGACATTTTCCAGCAAATTCCAAGTGGACAACAACAACCGCCTGTTACTGCAGCAGGTCTCATTGCCAGAGCTGCCTGGGGAATACAGCATGAAAGTGACAGGAGAAGGATGTGTCTACCTCCAGACATCCTTGAAATACAATATTCTCCCAGAAAAGGAAGAGTTCCCCTTTGCTTTAGGAGTGCAGACTCTGCCTCAAACTTGTGATGAACCCAAAGCCCACACCAGCTTCCAAATCTCCCTAAGTGTCAGTTACACAGGGAGCCGCTCTGCCTCCAACATGGCGATCGTTGATGTGAAGATGGTCTCTGGCTTCATTCCCCTGAAGCCAACAGTGAAAATGCTTGAAAGATCTAACCATGTGAGCCGGACAGAAGTCAGCAGCAACCATGTCTTGATTTACCTTGATAAGGTGTCAAATCAGACACTGAGCTTGTTCTTCACGGTTCTGCAAGATGTCCCAGTAAGAGATCTGAAACCAGCCATAGTGAAAGTCTATGATTACTACGAGACGGATGAGTTTGCAATTGCTGAGTACAATGCTCCTTGCAGCAAAGATCTTGGAAATGCTTGAAGACCACAAGGCTGAAAAGTGCTTTGCTGGAGTCCTGTTCTCAGAGCTCCACAGAAGACACGTGTTTTTGTATCTTTAAAGACTTGATGAATAAACACTTTTTCTGGTCAATGTC