Transcript asmbl_34768

Sequence
Transcript Sequence for observation asmbl_34768 of TGE0000212:
AGGGGGAGGGTTTCAAAGGGAGCGCACTTCCGCTGCCCTTTCTTTCGCCAGCCTTACGGGCCCGAACCCTCGTGTGAAGGGTGCAGTACCTAAGCCGGAGCGGGGTAGAGGCGGGCCGGCACCCCCTTCTGACCTCCAGTGCCGCCGGCCTCAAGATCAGACATGGCCCAGAACTTGAAGGACTTGGCGGGACGGCTGCCCGCCGGGCCCCGGGGCATGGGCACGGCCCTGAAGCTGTTGCTGGGGGCCGGCGCCGTGGCCTACGGTGTGCGCGAATCTGTGTTCACCGTGGAAGGCGGGCACAGAGCCATCTTCTTCAATCGGATCGGTGGAGTGCAGCAGGACACTATCCTGGCCGAGGGCCTTCACTTCAGGATCCCTTGGTTCCAGTACCCCATTATCTATGACATTCGGGCCAGACCTCGAAAAATCTCCTCCCCTACAGGCTCCAAAGACCTACAGATGGTGAATATCTCCCTGCGAGTGTTGTCTCGACCCAATGCTCAGGAGCTTCCTAGCATGTACCAGCGCCTAGGGCTGGACTACGAGGAACGAGTGTTGCCGTCCATTGTCAACGAGGTGCTCAAGAGTGTGGTGGCCAAGTTCAATGCCTCACAGCTGATCACCCAGCGGGCCCAGGTATCCCTGTTGATCCGCCGGGAGCTGACAGAGAGGGCCAAGGACTTCAGCCTCATCCTGGATGATGTGGCCATCACAGAGCTGAGCTTTAGCCGAGAGTACACAGCTGCTGTAGAAGCCAAACAAGTGGCCCAGCAGGAGGCCCAGCGGGCCCAATTCTTGGTAGAAAAAGCAAAGCAGGAACAGCGGCAGAAAATTGTGCAGGCCGAGGGTGAGGCCGAGGCTGCCAAGATGCTTGGAGAAGCACTGAGCAAGAACCCTGGCTACATCAAACTTCGCAAGATTCGAGCAGCCCAGAATATCTCCAAGACGATCGCCACATCACAGAATCGTATCTATCTCACAGCTGACAACCTTGTGCTGAACCTACAGGATGAAAGTTTCACCAGGGGAAGTGACAGCCTCATCAAGGGTAAGAAATGAGCCTAGTCACCAAGAACTCCACCCCCAGAGGAAGTGGATCTGCTTCTCCAGTTTTTGAGGAGCCAGCCAGGGGTCCAGCACAGCCCTACCCCGCCCCAGTATCATGCGATGGTCCCCCACACCGGTTCCCTGAACCCCTCTTGGATTAAGGAAGACTGAAGACTAGCCCCTTTTCTGGGGAATTACTTTCCTCCTCCCTGTGTTAACTGGGGCTGTTGGGGACAGTGCGTGATTTCTCAGTGATTTCCTACAGTGTTGTTCCCTCCCTCAAGGCTGGGAGGAGATAAACACCAACCCAGGAATTCTCAATAAATTTTTATTACTTAACCTGAA