Transcript asmbl_28939

Sequence
Transcript Sequence for observation asmbl_28939 of TGE0000090:
TTGAGGGAGGTCTTTGGCTTTTTTTGGCGGAGCTGGGGCGCCCTCCGGAAGCGTTTCCAACTTTCCAGAAGTTTCTCGGGACGGGCAGGAGGGGGTGGGGACTGCCATATATAGATCCCGGGAGCAGGGGAGCGGGCTAAGAGTAGAATCGTGTCGCGGCTCGAGAGCGAGAGTCACGTCCCGGCGCTAGCCCAGCCCGACCCAGGCCCACCGTGGTGCACGCAAACCACTTCCTGGCCATGCGCTCCCTCCTGCTTCTCAGCGCCTTCTGCCTCCTGGAGGCGGCCCTGGCCGCCGAGGTGAAGAAACCTGCAGCCGCAGCAGCTCCTGGCACTGCGGAGAAGTTGAGCCCCAAGGCGGCCACGCTTGCCGAGCGCAGCGCCGGCCTGGCCTTCAGCTTGTACCAGGCCATGGCCAAGGACCAGGCAGTGGAGAACATCCTGGTGTCACCCGTGGTGGTGGCCTCGTCGCTAGGGCTCGTGTCGCTGGGCGGCAAGGCGACCACGGCGTCGCAGGCCAAGGCAGTGCTGAGCGCCGAGCAGCTGCGCGACGAGGAGGTGCACGCCGGCCTGGGCGAGCTGCTGCGCTCACTCAGCAACTCCACGGCGCGCAACGTGACCTGGAAGCTGGGCAGCCGACTGTACGGACCCAGCTCAGTGAGCTTCGCTGATGACTTCGTGCGCAGCAGCAAGCAGCACTACAACTGCGAGCACTCCAAGATCAACTTCCGCGACAAGCGCAGCGCGCTGCAGTCCATCAACGAGTGGGCCGCGCAGACCACCGACGGCAAGCTGCCCGAGGTCACCAAGGACGTGGAGCGCACGGACGGCGCCCTGCTAGTCAACGCCATGTTCTTCAAGCCACACTGGGATGAGAAATTCCACCACAAGATGGTGGACAACCGTGGCTTCATGGTGACTCGGTCCTATACCGTGGGTGTCATGATGATGCACCGGACAGGCCTCTACAACTACTACGACGACGAGAAGGAAAAGCTGCAAATCGTGGAGATGCCCCTGGCCCACAAGCTCTCCAGCCTCATCATCCTCATGCCCCATCACGTGGAGCCTCTCGAGCGCCTTGAAAAGCTGCTAACCAAAGAGCAGCTGAAGATCTGGATGGGGAAGATGCAGAAGAAGGCTGTTGCCATCTCCTTGCCCAAGGGTGTGGTGGAGGTGACCCATGACCTGCAGAAACACCTGGCTGGGCTGGGCCTGACTGAGGCCATTGACAAGAACAAGGCCGACTTGTCACGCATGTCAGGCAAGAAGGACCTGTACCTGGCCAGCGTGTTCCACGCCACCGCCTTTGAGTTGGACACAGATGGCAACCCCTTTGACCAGGACATCTACGGGCGCGAGGAGCTGCGCAGCCCCAAGCTGTTCTACGCCGACCACCCCTTCATCTTCCTAGTGCGGGACACCCAAAGCGGCTCCCTGCTATTCATTGGGCGCCTGGTCCGGCCTAAGGGTGACAAGATGCGAGACGAGTTATAGGGCCTCAGGGTGCACACAGGATGGCAGGAGGCATCCAAAGGCTCCTGAGACACATGGGTGCTATTGGGGTTGGGGGGGAGGTGAGGTACCAGCCTTGGATACTCCATGGGGTGGGGGTGGAAAAACAGACCGGGGTTCCCGTGTGCCTGAGCGGACCTTCCCAGCTAGAATTCACTCCACTTGGACATGGGCCCCAGATACCATGATGCTGAGCCCGGAAACTCCACATCCTGTGGGACCTGGGCCATAGTCATTCTGCCTGCCCTGAAAGTCCCAGATCAAGCCTGCCTCAATCAGTATTCATATTTATAGCCAGGTACCTTCTCACCTGTGAGACCAAATTGAGCTAGGGGGGTCAGCCAGCCCTCTTCTGACACTAAAACACCTCAGCTGCCTCCCCAGCTCTATCCCAACCTCTCCCAACTATAAAACTAGGTGCTGCAGCCCCTGGGACCAGGCACCCCCAGAATGACCTGGCCGCAGTGAGGCGGATTGAGAAGGAGCTCCCAGGAGGGGCTTCTGGGCAGACTCTGGTCAAGAAGCATCGTGTCTGGCGTTGTGGGGATGAACTTTTTGTTTTGTTTCTTCCTTTTTTAGTTCTTCAAAGATAGGGAGGGAAGGGGGAACATGAGCCTTTGTTGCTATCAATCCAAGAACTTATTTGTACATTTTTTTTTTCAATAAAACTTTTCCAATGACA