Transcript asmbl_28694

Sequence
Transcript Sequence for observation asmbl_28694 of TGE0000063:
GAACCCCGCGGGCGGGGAGCGGGTGTGCGCAGCGCTAGGTGTGCGCTTCGCCCTGTAGGTAGAGAGACCCTTTGGTTAGCTTTCCACGCCAAGTGGCCGTTCCAGGCAGGCAGTGTCGTCTTGGTTCAGCCAAGGTCACAGAGGGAGTGATAGCTTCCGCGCAGCCCTGGCTACGGACTCTGGGCATCTTTCCACTGCCCCGCTTGCGCCACCTGTTAGGCAGGATCGTTTTTCCTCTGGGGCAAGATCAAAATCCAGGTCCTGCAGGAAGAAACTCCTCTTAAAAATAATTAAGCCTGATCAAGATGACAACCTCCCAAAAGCACCGAGACTTCGTGGCAGAGCCCATGGGGGAGAAGCCAGTGGGGAGCCTGGCTGGGATTGGTGAAGTCCTGGGCAAGAAGCTGGAGGAAAGGGGTTTTGACAAGGCCTATGTTGTCCTTGGCCAGTTTCTGGTGCTAAAGAAAGATGAAGACCTCTTCCGGGAATGGCTGAAAGACACTTGTGGCGCCAACGCCAAGCAGTCCCGGGACTGCTTCGGATGCCTTCGAGAGTGGTGCGACGCCTTCTTGTGATGCTCTCTGGGAAGCTCTCAATCCCCAGCCCTCATCCAGAGTTTGCAGCCGAGTAGGGACTCCTCCCCTGTCCTCTACGAAGGAAAAGATTGCTATTGTCGTACTCACCTCCGACGTACTCCGGGGTCTTTTGGGAGTTTTCTCCCCTAACCATTTCAACTTTTTTTTGGATTCTCGCTCTTGCATGCCTCCCCCGTCCTTTTTCCCTTGCCAGTTCCCTGGTGACAGTTACCAGCTTTCCTGAATGGATTCCCGGCCCCATCCCTCACCCCCACCCTCACTTTCAATCCGTTTGATACCATTTGGCTCCTTTTTTGGCAGAACAGTCACTGTCCTTGTAAAGTTTTTTAGATCAATAAAGTCAGTGGCTTTCATGA