Transcript asmbl_28693

Sequence
Transcript Sequence for observation asmbl_28693 of TGE0000063:
CCGGGCAGCAGAGAAAGGAAGTCCTCTCCCTGGAGGCCTATCTCCCTCAGAACTGCGCGAGAAGCGAGACCTTAGAAGGCAGGGCTTCCCGCGAAGGACCGGAAAGGAGCGCCTACTAAGGACGCCGTCGAGGTCCGGGGCGCCTCAACTCTATAGCTCTAACTGGCTAGAAGTGCCCAACGTGGAATGTTTCTTTTTTAAAGGCGGCTCTTGAAGCGACCCGGAAGCGGAAGTGGAAGAAAGTTCTAGTGGCTTGAGGTATCCGCAGGAGCGGCCGGGTGGCGGGAGGAACCGTTACGGGAACTGAAGTTGCGGATTAAGCCTGATCAAGATGACAACCTCCCAAAAGCACCGAGACTTCGTGGCAGAGCCCATGGGGGAGAAGCCAGTGGGGAGCCTGGCTGGGATTGGTGAAGTCCTGGGCAAGAAGCTGGAGGAAAGGGGTTTTGACAAGGCCTATGTTGTCCTTGGCCAGTTTCTGGTGCTAAAGAAAGATGAAGACCTCTTCCGGGAATGGCTGAAAGACACTTGTGGCGCCAACGCCAAGCAGTCCCGGGACTGCTTCGGATGCCTTCGAGAGTGGTGCGACGCCTTCTTGTGATGCTCTCTGGGAAGCTCTCAATCCCCAGCCCTCATCCAGAGTTTGCAGCCGAGTAGGGACTCCTCCCCTGTCCTCTACGAAGGAAAAGATTGCTATTGTCGTACTCACCTCCGACGTACTCCGGGGTCTTTTGGGAGTTTTCTCCCCTAACCATTTCAACTTTTTTTTGGATTCTCGCTCTTGCATGCCTCCCCCGTCCTTTTTCCCTTGCCAGTTCCCTGGTGACAGTTACCAGCTTTCCTGAATGGATTCCCGGCCCCATCCCTCACCCCCACCCTCACTTTCAATCCGTTTGATACCATTTGGCTCCTTTTTTGGCAGAACAGTCACTGTCCTTGTAAAGTTTTTTAGATCAATAAAGTCAGTGGCTTTCATGA