Transcript asmbl_28692

Sequence
Transcript Sequence for observation asmbl_28692 of TGE0000063:
CCGGGCAGCAGAGAAAGGAAGTCCTCTCCCTGGAGGCCTATCTCCCTCAGAACTGCGCGAGAAGCGAGACCTTAGAAGGCAGGGCTTCCCGCGAAGGACCGGAAAGGAGCGCCTACTAAGGACGCCGTCGAGGTCCGGGGCGCCTCAACTCTATAGCTCTAACTGGCTAGAAGTGCCCAACGTGGAATGTTTCTTTTTTAAAGGCGGCTCTTGAAGCGACCCGGAAGCGGAAGTGGAAGAAAGTTCTAGTGGCTTGAGATTAAGCCTGATCAAGATGACAACCTCCCAAAAGCACCGAGACTTCGTGGCAGAGCCCATGGGGGAGAAGCCAGTGGGGAGCCTGGCTGGGATTGGTGAAGTCCTGGGCAAGAAGCTGGAGGAAAGGGGTTTTGACAAGGCCTATGTTGTCCTTGGCCAGTTTCTGGTGCTAAAGAAAGATGAAGACCTCTTCCGGGAATGGCTGAAAGACACTTGTGGCGCCAACGCCAAGCAGTCCCGGGACTGCTTCGGATGCCTTCGAGAGTGGTGCGACGCCTTCTTGTGATGCTCTCTGGGAAGCTCTCAATCCCCAGCCCTCATCCAGAGTTTGCAGCCGAGTAGGGACTCCTCCCCTGTCCTCTACGAAGGAAAAGATTGCTATTGTCGTACTCACCTCCGACGTACTCCGGGGTCTTTTGGGAGTTTTCTCCCCTAACCATTTCAACTTTTTTTTGGATTCTCGCTCTTGCATGCCTCCCCCGTCCTTTTTCCCTTGCCAGTTCCCTGGTGACAGTTACCAGCTTTCCTGAATGGATTCCCGGCCCCATCCCTCACCCCCACCCTCACTTTCAATCCGTTTGATACCATTTGGCTCCTTTTTTGGCAGAACAGTCACTGTCCTTGTAAAGTTTTTTAGATCAATAAAGTCAGTGGCTTTCATGA